ID: 1026067678

View in Genome Browser
Species Human (GRCh38)
Location 7:67089422-67089444
Sequence GGTGCGGAAGACTCCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 2, 2: 0, 3: 6, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067669_1026067678 28 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65
1026067674_1026067678 2 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067678 Original CRISPR GGTGCGGAAGACTCCACTGC AGG Intronic
902517489 1:16997140-16997162 AGTGCTGAAGACGGCACTGCCGG - Exonic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
913263185 1:117019621-117019643 GGTAGGGACGAGTCCACTGCAGG - Intronic
916329571 1:163599625-163599647 GGGGAGGCTGACTCCACTGCAGG - Intergenic
919926228 1:202193263-202193285 GCTGCGGAGGGTTCCACTGCAGG - Intergenic
923680295 1:236113338-236113360 GGTCCTGAACACTCCACTGTGGG - Intergenic
1063692440 10:8299371-8299393 GCTGCGGGAGACACCACAGCAGG + Intergenic
1065770417 10:29072890-29072912 TGTGCGGAAGCCTCACCTGCAGG + Intergenic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1083602048 11:63954765-63954787 GGTGCGAGAACCTCCACTGCAGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1091710464 12:2736572-2736594 TATAAGGAAGACTCCACTGCAGG - Intergenic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1099019410 12:77384787-77384809 GGTGCAGAAAACTCCTCTGGAGG + Intergenic
1101879809 12:108618521-108618543 GGAGCTGAAGGCTCCACAGCAGG - Intergenic
1102536510 12:113585553-113585575 TGTGCGGAAGACTCAGCTGTTGG + Intergenic
1102713774 12:114952404-114952426 GGTGCAGGAGACCACACTGCGGG - Intergenic
1113982705 13:114289591-114289613 TGTGCAGAAGAATCCACTGGAGG - Intronic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1129833475 15:78685881-78685903 GGTGCAGATGACTCCACCGACGG - Intronic
1137483828 16:48875104-48875126 GGTGGGAGAGACTCCAATGCAGG - Intergenic
1139615380 16:68085440-68085462 GGTGCCTAAGCCTCCACTGTCGG - Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1141311798 16:82920600-82920622 GGTGAGGCTGTCTCCACTGCAGG + Intronic
1142294748 16:89213180-89213202 GCTGCGTAGCACTCCACTGCTGG + Intergenic
1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG + Exonic
1148563918 17:48621939-48621961 GGTGCGGAAGAATGCAGGGCCGG + Exonic
1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG + Intronic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1157619382 18:49007333-49007355 GGTTCTGCAAACTCCACTGCAGG - Intergenic
1160280646 18:77486783-77486805 TGTGCGGAATACTCTACAGCTGG - Intergenic
1161053121 19:2175907-2175929 TGTGCGGAAGAGCCCAGTGCTGG - Intronic
1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG + Intergenic
1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG + Intronic
1168489350 19:56795313-56795335 CGTGAGGAAGACTCCGCGGCGGG - Intronic
940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG + Intergenic
944386399 2:199169739-199169761 GGAGGGGTAGCCTCCACTGCCGG + Intergenic
1169164222 20:3408026-3408048 GGAGCGGAAGACTTCGCTGGAGG - Intergenic
1170211573 20:13850686-13850708 TCTGGGGAAGAATCCACTGCAGG - Intronic
1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG + Intergenic
1173183142 20:40819685-40819707 AGTGCGTAAGACTCCATTGTGGG - Intergenic
1173192962 20:40890190-40890212 GAGGAGGAAAACTCCACTGCTGG + Intergenic
1173339610 20:42141551-42141573 CATGCGGAAGACCCCACAGCTGG - Intronic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1181798113 22:25325093-25325115 GTTGTGTAAGACTACACTGCTGG - Intergenic
966690185 3:182733487-182733509 GGTAAGGAAGAATCGACTGCTGG - Intergenic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
970525451 4:16927520-16927542 GGTGCTGAACACTGCACTCCAGG + Intergenic
984205497 4:176783017-176783039 TGTGCTGAAGACTACAGTGCTGG - Intronic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
988484226 5:31655073-31655095 AGCACGGAAGACTCCACTGATGG - Intronic
993832799 5:92780257-92780279 AGTGCGGTAGACCCCACTTCAGG + Intergenic
1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG + Intergenic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1017966459 6:159271097-159271119 GGTGGGGAAGACCCCACCCCAGG + Intronic
1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG + Intergenic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1030396844 7:108996450-108996472 GGTTCGGAAGCTGCCACTGCAGG - Intergenic
1044957716 8:97498715-97498737 GATGTGGAAGAGTCCACTGGAGG - Intergenic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1062211555 9:135366950-135366972 GGTGCAGAGGAGTCCTCTGCTGG - Intergenic
1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG + Exonic
1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG + Intergenic
1195318965 X:103705818-103705840 GGTGTGGAAGAGCCCACTTCAGG - Intergenic
1198328130 X:135595198-135595220 CGTGAGGAAGAGTCCCCTGCAGG + Intergenic
1198634644 X:138682501-138682523 GGTTTGGAAGACTGCACTGTAGG - Intronic