ID: 1026067678

View in Genome Browser
Species Human (GRCh38)
Location 7:67089422-67089444
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 2, 2: 0, 3: 6, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067674_1026067678 2 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65
1026067669_1026067678 28 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type