ID: 1026068123

View in Genome Browser
Species Human (GRCh38)
Location 7:67093468-67093490
Sequence CCTAAAACTCAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026068123_1026068128 -5 Left 1026068123 7:67093468-67093490 CCTTCCACTTTCTGAGTTTTAGG 0: 2
1: 0
2: 1
3: 18
4: 241
Right 1026068128 7:67093486-67093508 TTAGGTTGGTTTTGGAGTTCAGG 0: 2
1: 0
2: 1
3: 29
4: 344
1026068123_1026068131 27 Left 1026068123 7:67093468-67093490 CCTTCCACTTTCTGAGTTTTAGG 0: 2
1: 0
2: 1
3: 18
4: 241
Right 1026068131 7:67093518-67093540 CCTTTCTACTCAGCTGCTCATGG 0: 2
1: 0
2: 1
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026068123 Original CRISPR CCTAAAACTCAGAAAGTGGA AGG (reversed) Intronic
901459688 1:9384186-9384208 CCAAAAAATGAGCAAGTGGATGG + Intergenic
905597682 1:39222373-39222395 CCTTAACCTCTGAAAGTGCAGGG + Intronic
905771010 1:40637991-40638013 CCCTAAACTCTGAAAGAGGAGGG - Intronic
905971990 1:42148851-42148873 GCTGAAACTCAGAGAGTGAAGGG + Intergenic
907134012 1:52122073-52122095 ACTAAAGCTCAGAAAGTTTAAGG - Intergenic
908364789 1:63409830-63409852 CTTAAATGTCAGAATGTGGAGGG + Intronic
910820457 1:91339315-91339337 CCTAGAATTCAGAATCTGGATGG + Intronic
911008276 1:93251248-93251270 CCAAAAATTCAAAATGTGGAAGG - Intronic
911127684 1:94355645-94355667 CCTAAAACTCTCAATGAGGAGGG - Intergenic
911497794 1:98651399-98651421 CCTCCAACTCAGAAAGGGGCGGG + Intergenic
913227198 1:116710619-116710641 CCCAAGACCCAGAAAGGGGAAGG + Intergenic
918743276 1:188164482-188164504 CCTGACTCTCAGAAAGTTGAGGG + Intergenic
919139193 1:193549256-193549278 CTTCAAACTCAGCAAGTGAAGGG - Intergenic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
921076599 1:211704885-211704907 ACTAAGCCTCAGTAAGTGGAAGG - Intergenic
921506606 1:215978894-215978916 CCTAGAAGTAAGAAAGTGCAAGG + Intronic
921676805 1:217985157-217985179 TATAAAACTCAGAATGTGAAGGG + Intergenic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
923253110 1:232195211-232195233 CCTAAATGACACAAAGTGGATGG - Intergenic
1062952744 10:1516910-1516932 CCTAAAACCCAGCACGTGAAAGG - Intronic
1063305257 10:4892818-4892840 CCTATTACTCACAAATTGGATGG - Intergenic
1064442536 10:15366900-15366922 ATTAAAACTGAGAAAGTGGCTGG + Intronic
1067170737 10:43904016-43904038 CCTGTAACTCAGAGAGTGGCAGG - Intergenic
1067931687 10:50568492-50568514 CCTAAAACTGATGAATTGGATGG - Intronic
1068176144 10:53461667-53461689 CCTAAAACTGAGAAAAAGCAAGG - Intergenic
1068238103 10:54264441-54264463 CATAGAACTCAGAAGATGGATGG + Intronic
1068398137 10:56490845-56490867 CCTAAGACTCAGAAAGGTTAAGG + Intergenic
1069537199 10:69263347-69263369 CCTAGAACTCCCAAAGTGGTAGG + Intronic
1069765155 10:70851281-70851303 CCTAATATTCTCAAAGTGGAGGG + Intronic
1070217060 10:74396235-74396257 TCAAAAACTCAGAAATTGGCCGG + Intronic
1071739250 10:88338206-88338228 ACTAAAACTAAGAAACTGCAGGG + Intronic
1073508882 10:104029823-104029845 GACAAAACTCAGAAAGAGGATGG - Intergenic
1074177385 10:111022828-111022850 GATAAAACTCAGAAAAGGGAGGG - Intergenic
1075485706 10:122820526-122820548 CCTAAAACCCAGCGAGTGGGTGG - Intergenic
1077505984 11:2930148-2930170 CATAGAGCTCAGAAAATGGAAGG + Intergenic
1078224078 11:9376340-9376362 CCTACAACTCAGTAACAGGAAGG + Intergenic
1080085342 11:28274053-28274075 AATAAAACTCAGCAAATGGAAGG + Intronic
1080580315 11:33637065-33637087 CAGAAAATTCAGCAAGTGGAAGG + Intronic
1080670947 11:34377200-34377222 CCTCAGACTCCCAAAGTGGAAGG + Intergenic
1081186812 11:40053083-40053105 TCTAGAAGTCAGAAAGTAGATGG - Intergenic
1082931680 11:58614207-58614229 GCTAAAACAGAGAAAGTGAAAGG - Exonic
1084538311 11:69771439-69771461 ATTAAAATTCAGAAAGTCGACGG + Exonic
1085422182 11:76372202-76372224 CCTAAACCTCACAAAGTGCTGGG + Intronic
1085794531 11:79525923-79525945 CATAAAAGCCAAAAAGTGGAAGG - Intergenic
1085888255 11:80546162-80546184 CATAGAATTCAGAAACTGGATGG + Intergenic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1088210075 11:107445007-107445029 TCTAAAACTAAGAAATGGGAAGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088737034 11:112736438-112736460 CCTAAAACTGAGAAAGTGCTGGG - Intergenic
1089382645 11:118047073-118047095 CCTAAAACTCATTCAGTGGTAGG - Intergenic
1089842469 11:121430377-121430399 CCAAAAAGACAGAAAGTAGAGGG - Intergenic
1091842153 12:3628929-3628951 CCTGACACTCTGGAAGTGGATGG - Intronic
1092522712 12:9290482-9290504 ACAAAAACAAAGAAAGTGGAAGG - Intergenic
1092544573 12:9441415-9441437 ACAAAAACAAAGAAAGTGGAAGG + Intergenic
1093032871 12:14304971-14304993 CCTAAAACTTAGAAATTTAAAGG - Intergenic
1095934202 12:47659069-47659091 CCTAAAACTGGAAAAGTTGATGG - Intergenic
1097372621 12:58802725-58802747 TCCAAACCTCAGAAAGTTGACGG + Intronic
1097514819 12:60591921-60591943 ACTAAAACTCAGAAAGATTAGGG + Intergenic
1098187089 12:67908794-67908816 CCTGGAACTCAATAAGTGGATGG - Intergenic
1098247593 12:68536174-68536196 CCTTGAACCCAGGAAGTGGAGGG + Intergenic
1098706651 12:73699822-73699844 CCTAGAACTCAGAAAATCTAAGG - Intergenic
1099913574 12:88863325-88863347 CTTAAAACTGAGAGAGTGAATGG + Intergenic
1101019481 12:100538798-100538820 CATAAAACTCATAAAGTGTGAGG + Intronic
1101385652 12:104255021-104255043 CTTAAAACTCAGGAAGCTGAGGG + Intronic
1102776738 12:115526279-115526301 ACTAAAACTTAGAAAGTTAAAGG + Intergenic
1103406478 12:120679362-120679384 GCTAAAGCTCAGAGAGTTGAGGG - Intergenic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1104279989 12:127367937-127367959 CCTAAAACTCAGACAGTTTAAGG + Intergenic
1104524933 12:129512181-129512203 ACTGAAACTCAGAAAGTAGTGGG - Intronic
1105561665 13:21498003-21498025 CCTTAGCCTCAGAAAGTGCAGGG + Intronic
1110286301 13:73753557-73753579 CCTAGAGCACAGAAAGTGGCTGG + Intronic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1111017061 13:82394798-82394820 CCTATAGCTCAGCAAGTAGAAGG - Intergenic
1111244208 13:85514168-85514190 ACCAAAACTTAAAAAGTGGAGGG + Intergenic
1112166061 13:96920746-96920768 CCAAAAACACACAAATTGGATGG - Intergenic
1112938074 13:104825686-104825708 ACGTAAACTCAGAAAATGGATGG - Intergenic
1115587071 14:34825064-34825086 CCTAAAATTCAGACAATTGATGG - Intronic
1115849723 14:37581367-37581389 CAAGAAACTCAGGAAGTGGAAGG + Intergenic
1115989169 14:39134045-39134067 CCTAAGCCTCCGAAAGTGCAGGG + Intronic
1116366587 14:44074495-44074517 ACTAAATCTCAAAAACTGGAGGG + Intergenic
1116495601 14:45555866-45555888 CCTCAAACTGAGAAAGTAGTAGG + Intergenic
1117662884 14:58026715-58026737 CCTAAAATTGAGAATGAGGAGGG - Intronic
1118050512 14:62021367-62021389 CCTACATCTGAGAAAGAGGAAGG - Intronic
1120299272 14:82685271-82685293 TTTATAACTCAGAAATTGGATGG + Intergenic
1120611549 14:86647133-86647155 TCTAAAATTCAGAATCTGGATGG + Intergenic
1125797745 15:42416026-42416048 CTCAAAACTCAGAACGTGGCCGG - Exonic
1127215447 15:56818634-56818656 CCTAAAACTGAGAAAGTTCCAGG - Intronic
1129583043 15:76832159-76832181 CCTACAACTCAGAATCTGGATGG + Intronic
1130691634 15:86086373-86086395 CCTGAAATAAAGAAAGTGGAGGG + Intergenic
1130930759 15:88425741-88425763 CATAAAACTTAGAAAGCAGATGG + Intergenic
1135702145 16:24641872-24641894 CCTAAAACTCAATCAGTGGCAGG + Intergenic
1136030265 16:27497698-27497720 CCTCTAGATCAGAAAGTGGACGG - Exonic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1139061382 16:63257063-63257085 TATAAAACTGAGAAACTGGAAGG - Intergenic
1140118975 16:72067036-72067058 CCCAAAACTGAGAGAGGGGAAGG + Intronic
1140783604 16:78318593-78318615 TCTACAACTGAGAAAATGGAAGG - Intronic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1143930958 17:10423937-10423959 TCTAAAACTCATATAGTAGAAGG - Intergenic
1144257030 17:13478810-13478832 CCTAAAAATGAGCAAGTAGAAGG + Intergenic
1144315498 17:14057082-14057104 CTTAAAACTAAGGAAGTGGGTGG - Intergenic
1147175768 17:38655268-38655290 CCTGAAACTCAGCAAGGGGTGGG + Intergenic
1147394494 17:40131236-40131258 CCTTAAACTCAGAACATGGCAGG - Intronic
1149299789 17:55294546-55294568 CCTTACACACAGAAAGGGGAAGG - Intronic
1150962469 17:69929404-69929426 CCTAATAGTCAGCAACTGGAAGG + Intergenic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1152511516 17:80792829-80792851 TCTAAAACTCAGAAAACAGAGGG - Intronic
1157045478 18:44098352-44098374 CATAAAATTCAGAATCTGGATGG - Intergenic
1157593773 18:48851568-48851590 CCTAAACCTCAGAACCTGGCAGG + Intronic
1157989714 18:52480052-52480074 CCTAAGACTCAGAATGATGAAGG + Intronic
1158043637 18:53128670-53128692 TATTCAACTCAGAAAGTGGAAGG + Intronic
1159148009 18:64480222-64480244 CCTAGAACACAGAAAGTGGATGG + Intergenic
1161840891 19:6679641-6679663 CCCAAAGATCAGAAAGTAGAGGG - Intronic
1162467868 19:10853446-10853468 ACTAAAACTCAAAAAGTAGCTGG - Intronic
1163901933 19:20109980-20110002 TCATAAAATCAGAAAGTGGAAGG - Intronic
1163947118 19:20548456-20548478 TCATAAAATCAGAAAGTGGAAGG + Intronic
1164435329 19:28223703-28223725 CCTCAAACTCGGAAACTGTAAGG - Intergenic
1164926876 19:32137616-32137638 CCATAACCCCAGAAAGTGGAAGG + Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
926298647 2:11586757-11586779 CCTAAAACACAAAAACTGGACGG + Intronic
926536281 2:14116922-14116944 AACAAAACTCAGAAAGTGGGTGG + Intergenic
926918648 2:17917539-17917561 CCTAATTCTCAGCAAGTGGGGGG - Intronic
927326157 2:21807743-21807765 CCTGAAACAGAGAAAGTGGAGGG - Intergenic
927972567 2:27315034-27315056 CCTGAAACTCCCAAAGTGGTGGG + Intronic
928163866 2:28955224-28955246 CCTAAGAATCAGCAAGTGGCTGG - Intergenic
928205835 2:29282790-29282812 CCTCAAACTGAGAATGTGGAAGG - Intronic
929728481 2:44459018-44459040 CCTAAAACTCAAAAAGTTGGTGG - Intronic
929854010 2:45620442-45620464 CCTATGACTCAAAAATTGGAAGG - Intergenic
935381364 2:102454019-102454041 CTTAAATCTCAGAGAGTGGCGGG - Intergenic
935747609 2:106202636-106202658 AATAAAACTCATAAAGTAGATGG + Intergenic
936629952 2:114191523-114191545 TCTAAAACTCGGAAAAAGGATGG - Intergenic
938907867 2:135855689-135855711 CCAAACACTCACAAAATGGAAGG + Intronic
939344215 2:140941968-140941990 CATAGAATTCAGAAACTGGATGG + Intronic
940254079 2:151710760-151710782 CCCCAAACTCAGCAAGGGGAGGG - Intronic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940985313 2:160046370-160046392 CCTAAACCCCAGACATTGGAGGG - Intronic
942367084 2:175239208-175239230 CCTACATTTCAGAATGTGGATGG - Intergenic
943722816 2:191222762-191222784 GCCAATACTCAGAAAGTGCAGGG - Intergenic
944157885 2:196627040-196627062 ACTAAAACACAGAGAGTGTAAGG + Intergenic
945324947 2:208471572-208471594 CCTAAATTTCAGAAAATGTATGG + Intronic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
948767235 2:240229006-240229028 CCTCAAACTCACAAAGTGTTGGG + Intergenic
948922968 2:241074512-241074534 CCTAGAACTCAGAGATTGGAGGG + Intronic
1170263086 20:14434416-14434438 CCTAATACTGGGAAAGGGGATGG - Intronic
1172029890 20:31974444-31974466 CCCAAATCACAGAAAGTGGCAGG - Intronic
1174164276 20:48573765-48573787 GCTAAAAATCAGAAACTGGCTGG - Intergenic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1183124354 22:35761468-35761490 CCTGAAACACACAAAATGGAAGG + Exonic
949590733 3:5491624-5491646 CCTAAACCTCAGAGAGGAGATGG + Intergenic
949860941 3:8504178-8504200 CCTTCAACTCAAAATGTGGAGGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
953396489 3:42575624-42575646 GCAAAAACTCATAAAGTGAAAGG + Intronic
954016795 3:47699801-47699823 ACTAAAACTCAGGAAGTATACGG - Intronic
955645616 3:61134211-61134233 CATAAGCCTCAGAAAGTGGTGGG + Intronic
957202537 3:77155346-77155368 CCTAAAATTGAAAGAGTGGAGGG + Intronic
960347258 3:116548785-116548807 TCTTAAACTCAGTAAGTAGAAGG + Intronic
960442998 3:117711947-117711969 CTTAAAAGTCAGAAAGAGGTAGG - Intergenic
962068465 3:132008994-132009016 CCTATAACTCTCAAAGTTGATGG + Intronic
964058570 3:152491982-152492004 GCTAAAACTCAGAAATGTGACGG + Intergenic
965845227 3:172953422-172953444 AGTAAGACTCAGAAAGTGGCTGG + Intronic
967812699 3:193774096-193774118 CCAAAAAGTCAGTAAGTGGCTGG + Intergenic
970460723 4:16272384-16272406 CCTAAAAATGGGAAAGGGGAGGG - Intergenic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971415210 4:26420472-26420494 CCTAAAACTCAGAATGGCCATGG - Intronic
973034544 4:45390061-45390083 CATAAAATTCAGAATCTGGATGG - Intergenic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
973579608 4:52329736-52329758 CCAAACACTCAAAATGTGGAAGG - Intergenic
974092125 4:57322330-57322352 CCTCAAACTTAGAAGGTGCAGGG + Intergenic
974595275 4:64006365-64006387 ACTAAAACTCAGAGAGAGAATGG + Intergenic
975834301 4:78405766-78405788 CCTAACACTCTGATAGTGGGAGG - Intronic
977084268 4:92574649-92574671 CCTAAAACCCAGAGATTGGAGGG - Intronic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
978283480 4:107045534-107045556 ACTCAAACCCAGGAAGTGGAGGG + Intronic
979079994 4:116325569-116325591 ACTAAAATTCAGAAATTTGATGG - Intergenic
979325138 4:119370490-119370512 CCTACATCCCAGAAAGAGGAAGG - Intergenic
979384948 4:120053876-120053898 GTTAAAACTCACAAAGTAGAAGG + Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981224597 4:142278413-142278435 CCTAATACTCAGAAAAATGAAGG + Intronic
983069819 4:163254567-163254589 CCTCCAACTCAGAAAGGGCAGGG + Intergenic
983243043 4:165255514-165255536 CCTACATCCCAGAAAGAGGAAGG - Intronic
984353836 4:178632338-178632360 CCTAAAACCAAATAAGTGGAAGG - Intergenic
984531421 4:180921226-180921248 ACTAACTCTCAGAAAGGGGAGGG - Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
986079750 5:4378012-4378034 CCTAGAACACAGAATGTGGCAGG + Intergenic
986741124 5:10706147-10706169 CCTAACACCCTGTAAGTGGATGG - Intronic
987168221 5:15223165-15223187 TCTAAAACACAGAAAGTAAAAGG - Intergenic
987416601 5:17669179-17669201 ACTAAAACACAGAAGGTGCAGGG + Intergenic
987540547 5:19248916-19248938 CCTAAAACTGAGAATTTGCAAGG + Intergenic
988316494 5:29636554-29636576 CCAAAAATTCAAAATGTGGAGGG + Intergenic
988659329 5:33247407-33247429 ACAAAAACTCAGAAAATGAAGGG + Intergenic
991134424 5:63164686-63164708 CCTAAACCTCAGAAGGTGTGAGG - Intergenic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
991571499 5:68059109-68059131 ATAAAAACTAAGAAAGTGGAAGG - Intergenic
995265550 5:110154920-110154942 ACCAAAAGTCAAAAAGTGGAGGG + Intergenic
995328893 5:110924058-110924080 CCTAAGACCTAGAAAGTGCATGG + Intergenic
995455484 5:112347643-112347665 CCCAAAGCTCAGACAGTGAAAGG - Intronic
996037530 5:118774919-118774941 ACTGAAGCTCAGAAAGTGCAAGG - Intergenic
996118175 5:119642314-119642336 CCTGAGACTCAGAAAGTGTCAGG + Intergenic
997179129 5:131810031-131810053 GCTAAAATTCAGAAAGTTTAAGG + Intronic
997966727 5:138363091-138363113 CCTAACCCTCAGAAGGTAGAGGG + Intronic
998200143 5:140113007-140113029 CCCAAATCTCAGAAGGAGGAGGG + Intronic
999563939 5:152836838-152836860 GCTAAAACTCAGAAACTAGAAGG + Intergenic
999779306 5:154836192-154836214 ATTAAAAGTCAGAAAGTGGCCGG - Intronic
999936322 5:156489755-156489777 CCTACACCAAAGAAAGTGGAAGG + Intronic
1000333014 5:160220670-160220692 CCTCATACTCAGGAAGTGGTCGG + Intronic
1000679774 5:164168834-164168856 GCTAGAACACAGCAAGTGGAAGG - Intergenic
1001536914 5:172504454-172504476 CCTGAAGCTCAGAAGCTGGATGG + Intergenic
1002148975 5:177210881-177210903 TCTAAAAGTGGGAAAGTGGATGG + Exonic
1004289983 6:14358029-14358051 GCTAAAAATCTGCAAGTGGATGG - Intergenic
1010117163 6:72327438-72327460 CGCAAAAGTCAAAAAGTGGATGG - Intronic
1010933232 6:81829204-81829226 CCTAAAACTCAGAAATTTAAGGG + Intergenic
1012391367 6:98744475-98744497 CCTAACAGTCAGAAGGTGGCTGG - Intergenic
1012573187 6:100757828-100757850 CCCACAACTCAGAAAGTCAATGG + Intronic
1013509643 6:110832801-110832823 CCTAAAAAACAAAAAGTGGATGG - Intronic
1017680159 6:156855452-156855474 CGTGAAACACACAAAGTGGACGG - Intronic
1019571244 7:1713486-1713508 CCTTGAACACAGGAAGTGGAGGG - Intronic
1019612202 7:1942234-1942256 GCCAACACTCAGCAAGTGGAGGG + Intronic
1024008193 7:45242755-45242777 CCTAAAGCTCAGAAGGTGAAGGG + Intergenic
1024422620 7:49186871-49186893 CCTAAAACTCTGAAAGTTTCAGG - Intergenic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026515463 7:71066918-71066940 CCCCAAACTCATTAAGTGGAAGG + Intergenic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1027156490 7:75772003-75772025 CCTAAAAATCAGGGAGAGGAAGG + Exonic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028217367 7:88150987-88151009 CCTAATATTCATAAAATGGATGG + Exonic
1029578232 7:101418379-101418401 CCTAAGAGACAGAAAGTAGATGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030806828 7:113929746-113929768 CCTAAATCTCAGAAGATGTATGG + Intronic
1030940483 7:115640870-115640892 CATAAAAGTAAGAAAGTGCAAGG - Intergenic
1032363007 7:131273415-131273437 ACAAAAACTCAGAAAGTGCAGGG - Intronic
1034491768 7:151396618-151396640 CCTAAGACTGAGAAAGTCCAGGG + Intronic
1039411902 8:37361701-37361723 CCTAAAACTCTCAATGTGGTGGG + Intergenic
1040811876 8:51462326-51462348 CATAAAATTCAGAATCTGGATGG + Intronic
1043381801 8:79710366-79710388 GCTTGAACTCAGAAGGTGGAGGG - Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1048110543 8:131463293-131463315 AATAAAACTCAGAAAGTGCAGGG - Intergenic
1048225350 8:132579622-132579644 ACTACAACTAAGAAAGTGGGGGG + Intronic
1050942532 9:11478057-11478079 CCTCAAACTCACAAAGTGCTGGG - Intergenic
1051682760 9:19624524-19624546 CATAAAACATAAAAAGTGGAAGG + Intronic
1051858412 9:21596504-21596526 CCTAAAATTCTTAAATTGGAGGG + Intergenic
1052575078 9:30281290-30281312 CCTAGAACTCAAAGACTGGAAGG - Intergenic
1052828600 9:33196368-33196390 CCTCAAACTCCCAAAGTGCAGGG - Intergenic
1058801453 9:108548305-108548327 ACTAAAACTCAGAAGGATGAAGG - Intergenic
1059518138 9:114914730-114914752 ACTAAAACCCAGAAAGGAGAAGG + Intronic
1059778973 9:117507112-117507134 CATAAAATTCAGAATCTGGATGG - Intergenic
1062508954 9:136894383-136894405 CCCAGATCTCAAAAAGTGGAAGG - Intronic
1185571768 X:1139997-1140019 CCTCAACCTCACAAAGTGGAGGG + Intergenic
1187146538 X:16642544-16642566 CCCAACACTCAGGAAGCGGAAGG + Intronic
1187197655 X:17103440-17103462 CCTAAAACGCAGCAAGGGAAAGG - Intronic
1190827741 X:54032994-54033016 CATAAAACTCTGAAAGGTGAAGG + Intronic
1191011518 X:55764103-55764125 CCTGAAACTGAGAATGTTGAGGG + Intergenic
1192139052 X:68631935-68631957 CCAAAAAGTTAGAAAGTGGAAGG + Intergenic
1192756435 X:74050697-74050719 CATAAAATTCAGAATCTGGATGG + Intergenic
1193485464 X:82080805-82080827 CCCCAGACTCAGTAAGTGGAGGG - Intergenic
1193979791 X:88168359-88168381 CCTAGAATTCAGAATCTGGATGG - Intergenic
1194237546 X:91402900-91402922 CCTATCAATCAGCAAGTGGATGG + Intergenic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1196368284 X:114947147-114947169 CCTAAATCTCAGAAGATGTATGG - Intergenic
1199835166 X:151582578-151582600 CCTAGAACTCAAATACTGGAGGG + Intronic
1200557959 Y:4661789-4661811 CTTAAACCTAAGAAAGTAGAAGG + Intergenic
1200760286 Y:7031883-7031905 CCAAAGACACAGACAGTGGAAGG + Intronic