ID: 1026068222

View in Genome Browser
Species Human (GRCh38)
Location 7:67094786-67094808
Sequence GATCCAGGAGTGGCCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 2, 2: 4, 3: 17, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026068222 Original CRISPR GATCCAGGAGTGGCCAACCT GGG Intronic
902227755 1:15007511-15007533 GGTCCAGATGTGGCCAGCCTGGG - Intronic
902384551 1:16068866-16068888 AATCCAGCAGAGGCCAATCTGGG - Intronic
904058180 1:27686060-27686082 AATCCAGGAGTTTCCACCCTGGG - Intergenic
904906484 1:33900967-33900989 GATCCTGGAGTGGCTGGCCTAGG + Intronic
905865384 1:41373694-41373716 GATCCTAGAGTGGGCAGCCTGGG - Intronic
908342505 1:63196265-63196287 GATCAAGGAGTGGCAAAGCTTGG + Intergenic
911618042 1:100036830-100036852 ATTCCAGGAGTGGCTAAGCTAGG + Intergenic
912558510 1:110533576-110533598 GGTACAGGAGTGGCTCACCTGGG + Intergenic
914961566 1:152213925-152213947 CTTCCAGCAGTGGCCAACATGGG - Exonic
914961814 1:152215335-152215357 CTTCCAGCAGTGGCCAACATGGG - Exonic
914962061 1:152216745-152216767 CTTCCAGCAGTGGCCAACATGGG - Exonic
914962311 1:152218155-152218177 CTTCCAGCAGTGGCCAACATGGG - Exonic
915444234 1:155965734-155965756 CATCCGGGAGCGGCCAAGCTCGG - Exonic
919924616 1:202185940-202185962 GTCCCAGGAGTGCACAACCTGGG - Intergenic
922128612 1:222754655-222754677 AATCCAGGAGTGGCTTAGCTGGG - Intergenic
923338958 1:232991802-232991824 GATCCAGGTGTGGGCAGGCTTGG - Intronic
924816459 1:247446180-247446202 GGTCAGGGAGTGGCCAAGCTGGG - Intronic
1063184923 10:3642078-3642100 GATCAAGGATTGGCCAATCATGG + Intergenic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1065673759 10:28152227-28152249 AATCCAGGAGTGGGCAGGCTAGG - Intronic
1067844406 10:49708548-49708570 GATCCAGGCCTGGCCAACCCAGG - Exonic
1070420318 10:76229798-76229820 GCTCCAGGAGCACCCAACCTGGG + Intronic
1071713947 10:88076420-88076442 GATGCAGGGGTGGCCAACAGTGG + Intergenic
1073179012 10:101572885-101572907 AATCCAGGTGTTGCCAGCCTGGG + Intronic
1076821938 10:132943679-132943701 CACCCAGGAGAGGCCCACCTGGG + Intergenic
1077147274 11:1051869-1051891 GGTCCAGGAGTGGAGAACCCAGG - Intergenic
1081772572 11:45658967-45658989 GATCCAGGAGTCTCCAGCCTGGG + Intronic
1083083961 11:60123567-60123589 AATCTAGGAATGGCCAACCTGGG + Intergenic
1083889908 11:65590521-65590543 GATCCAGGAGTGGTTCACCCTGG + Exonic
1083895001 11:65615589-65615611 GACCCAGGCGTTGCCAACCCAGG - Intronic
1086071318 11:82803106-82803128 GTTCCAGGAGAGACCAAGCTTGG + Intergenic
1089631726 11:119788414-119788436 GATACAGGGGTGGCCAGACTTGG - Intergenic
1091993571 12:4975594-4975616 CATCCTGGAGAGGCCAACCAAGG - Intergenic
1092239960 12:6830299-6830321 GATCCAGGGGTTGCCAAACTGGG - Intronic
1092462133 12:8696676-8696698 GATCCAGAAGTTACCACCCTGGG + Intronic
1096324553 12:50647765-50647787 GATCCATGAGTGGCACACCTGGG - Intronic
1098901445 12:76115750-76115772 GATCCAGCAGTGAACAACCTTGG + Intergenic
1099228035 12:79992929-79992951 GAGCCAGCAGTGGCAACCCTTGG - Intergenic
1108356151 13:49630430-49630452 GATTCAGCAGTGGCCACCATGGG + Exonic
1111849093 13:93549561-93549583 GATCCAGGAGTGCTCAGCCTGGG - Intronic
1114246682 14:20920929-20920951 GAGCCACCAGTGCCCAACCTAGG + Intergenic
1115532777 14:34342447-34342469 GATCCAGGAGTGGCCTAGAAAGG - Intronic
1120772999 14:88401621-88401643 AGGCCAGGAGTGGCCAGCCTGGG + Intronic
1121523029 14:94599440-94599462 GTGCCAGGAGTAGCCAGCCTGGG + Intronic
1123973588 15:25531555-25531577 GATCCTGGACTGGCCAAGTTAGG + Intergenic
1132946730 16:2535887-2535909 AATCCAGGAGAGGCCAGGCTGGG - Intergenic
1140054658 16:71515609-71515631 AATACAGGAGTGACCAGCCTGGG + Intronic
1142304445 16:89277758-89277780 GATCCAGGAGCGGGCGCCCTCGG - Intronic
1143818835 17:9543006-9543028 GATGCTGAAGGGGCCAACCTAGG - Intronic
1144160490 17:12553001-12553023 GATCCGGGAGTGGGCAAACTAGG - Intergenic
1145254380 17:21314657-21314679 GATAGAGGTGTGGCCACCCTGGG - Exonic
1145322216 17:21773305-21773327 GATAGAGGTGTGGCCACCCTGGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149721713 17:58851705-58851727 GACCCAGGAGTAGCCTAACTGGG - Intronic
1151492989 17:74443662-74443684 AACCCAGGAGTGGCCAACTTGGG - Intronic
1152390948 17:80003320-80003342 GTTCCCGGGGTGGCCAGCCTAGG - Intronic
1153314784 18:3711079-3711101 GAGCCAGGAGGGGCCGCCCTGGG + Intronic
1155165121 18:23225942-23225964 GGGCCAGGAGTGGGAAACCTGGG + Intronic
1163177828 19:15576831-15576853 GATCCCAGAGTAGCCCACCTTGG - Intergenic
1165069815 19:33248797-33248819 GAGCCAGGAGGGACCAACCCAGG + Intergenic
1165393284 19:35550410-35550432 GCTCCAGGAGGTGCGAACCTTGG + Exonic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166707646 19:44917018-44917040 GACCCAGGTCTGGCCAAGCTTGG - Intronic
930501226 2:52220777-52220799 AATGAAGGAGTGGCCCACCTTGG + Intergenic
932458735 2:71867617-71867639 GATCCAGCAGTTGCAATCCTTGG - Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
934726490 2:96623647-96623669 GATCCAGGAGAACCCTACCTAGG + Intronic
937218214 2:120326127-120326149 GCTCCAGGTGTAGACAACCTTGG - Intergenic
937320367 2:120957138-120957160 TATCCATGAGGGGCCAGCCTCGG - Intronic
938140996 2:128794484-128794506 GATTGAGGAGAGGCCAACATGGG - Intergenic
938614818 2:132986898-132986920 AATCCAGGAGTGGACAATCCAGG + Intronic
947623032 2:231603270-231603292 GATCCAGGCTGGGCCAACCAGGG - Intergenic
1169368346 20:5009384-5009406 GTTCCAGGAGAGGCCAAGGTGGG - Intronic
1170187610 20:13608752-13608774 GATCAAGGATTGGCCAACTATGG - Intronic
1172774656 20:37400035-37400057 GATCCAGGATCTGCCCACCTGGG - Intronic
1173982102 20:47232479-47232501 AACCCAGGAGTGGCCAGCCTGGG + Intronic
1174264391 20:49320704-49320726 CTGCCAGGAGTGGCCAACGTTGG + Intergenic
1180793097 22:18587858-18587880 GTTCCATGAGTGGCCTCCCTTGG - Intergenic
1181045671 22:20213162-20213184 GATCCAGGATTGGCAAAGCAGGG - Intergenic
1181228640 22:21407460-21407482 GTTCCATGAGTGGCCTCCCTTGG + Intergenic
1181250009 22:21527405-21527427 GTTCCATGAGTGGCCTCCCTTGG - Intergenic
1181579014 22:23816649-23816671 GATGCAGGAGAGGACAACCAGGG - Intronic
1181874910 22:25932724-25932746 AATCCAGGAGTTGGCAAACTAGG + Intronic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183339880 22:37274225-37274247 GATCCTGGAGGGGCCATCATGGG - Intergenic
1184664767 22:45982425-45982447 GATCCTTGTGTGGCCAACCAAGG - Intergenic
1184789973 22:46694437-46694459 GAGCCTGCAGTGGCCAAACTGGG + Intronic
953826188 3:46252963-46252985 AGTCCAGGAGTTGTCAACCTTGG + Intronic
959827072 3:110810695-110810717 GATCCTATAGTGGCCAAGCTAGG + Intergenic
961362302 3:126375782-126375804 GATCCAGGAGGGGCCATCAGGGG + Intergenic
963790583 3:149578461-149578483 GAACCAAGTGTTGCCAACCTTGG - Intronic
966245926 3:177808234-177808256 GAGCCAGCAGTGGCAACCCTAGG - Intergenic
966712724 3:182986014-182986036 CATCTAGGAGTGGCCAAGCTGGG - Intergenic
970034937 4:11722611-11722633 AATCCGGGAGTGGCTTACCTAGG - Intergenic
970962677 4:21891174-21891196 AATCCAAGAGTGGTCAACCCAGG - Intronic
971402416 4:26288212-26288234 AATCCAGGAGTGGCTTAGCTGGG + Intronic
974880719 4:67753841-67753863 GATCCAGGCCAGGCCAACCATGG + Exonic
975719177 4:77233846-77233868 AATCCAAGAGTGGCCAACCTGGG + Intronic
981141739 4:141277441-141277463 AATCCTGGAGTGGCTCACCTGGG + Intergenic
982767268 4:159363371-159363393 GATCCAAGAGTTGCCAATGTGGG + Intergenic
989536078 5:42565120-42565142 GCTCCAGGTGTGGCCACACTGGG + Intronic
993034749 5:82744619-82744641 GCTACAGGTGAGGCCAACCTGGG + Intergenic
999340300 5:150764484-150764506 AGTCCAGGAGTTGCTAACCTGGG - Intergenic
999762540 5:154713631-154713653 GATCTAGGAGTTCCCCACCTGGG - Intronic
999845061 5:155470213-155470235 AATCTGGGAGTGGCCAACCCAGG - Intergenic
1004013948 6:11715434-11715456 GATCAAGAGGTGGCCATCCTAGG - Intronic
1006747722 6:36356602-36356624 GATCCAGGATAGGCCAATCAGGG - Intronic
1008423203 6:51327150-51327172 GATCCAGGCCTGGCCAACCATGG + Intergenic
1010692008 6:78921641-78921663 GACCCACGAGTGGCCTAACTGGG + Intronic
1017691541 6:156970852-156970874 GATCCAGGGTTGGCAAAGCTAGG - Intronic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1018681492 6:166269486-166269508 GGTCCAGGAGTGGGCAGCATGGG + Intergenic
1019362601 7:612703-612725 GCTGCTGGAGTGGCCACCCTTGG + Intronic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1034028785 7:147737447-147737469 GACCCAGGAGTAGCCAAACTGGG - Intronic
1036130799 8:6107990-6108012 AATCCAAGTGTGGCTAACCTAGG - Intergenic
1037951801 8:23023373-23023395 GATGCAGAAGTGGCCGCCCTGGG - Intronic
1037959457 8:23084913-23084935 GATGCAGAAGTGGCCGCCCTGGG - Intronic
1037965082 8:23127897-23127919 GATGCAGAAGTGGCCACCCTGGG + Intergenic
1037973573 8:23192404-23192426 GATGCAGAAGTGGCCACCCTGGG - Intronic
1042533123 8:69834403-69834425 GATGCCGGAGCGGCCACCCTTGG - Intronic
1044842270 8:96346585-96346607 GTATCAGGAGTGGCCAACCCTGG + Intergenic
1045380244 8:101616708-101616730 GATCCAGCAGTGACCAACACAGG - Intronic
1048331627 8:133474653-133474675 CATCCAGCAGAGGCCACCCTCGG + Intronic
1050078089 9:1885814-1885836 GATCAAGAAATGGTCAACCTGGG + Intergenic
1052453311 9:28661335-28661357 CATCCTGGAGTAGCCAGCCTTGG + Intronic
1059426205 9:114222406-114222428 GGGCCAGGAGAGACCAACCTGGG + Intronic
1061836643 9:133333883-133333905 GATCCATGAGTGGCCACAGTGGG - Intronic
1062599545 9:137313679-137313701 CCTGCAGGAGTTGCCAACCTGGG + Intronic
1187401356 X:18963232-18963254 GGTCCAGGCCTGGCCAATCTGGG + Intronic
1196156683 X:112438123-112438145 GATTCAGGAGTGGCTTAGCTGGG + Intergenic
1197758165 X:130010578-130010600 GATCCAGAAGGGGCTAACCGAGG - Intronic
1198502098 X:137260392-137260414 GATCCAGGAGTGGCTTAGGTAGG + Intergenic
1200962952 Y:9011737-9011759 GAGCCAGCAGTGGCCACCCACGG - Intergenic
1202381044 Y:24276732-24276754 GGTCCTGGAGAGGCCAACTTCGG - Intergenic
1202489741 Y:25393394-25393416 GGTCCTGGAGAGGCCAACTTCGG + Intergenic