ID: 1026075316

View in Genome Browser
Species Human (GRCh38)
Location 7:67161447-67161469
Sequence TTAGATTACCACGTATCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026075316 Original CRISPR TTAGATTACCACGTATCTTT TGG Intronic
903084820 1:20846573-20846595 TTAATTTACTACCTATCTTTAGG + Intronic
909108486 1:71443372-71443394 TTAGATAGCAACGTATTTTTAGG - Intronic
909337461 1:74492260-74492282 TTATATTACCACTCACCTTTGGG - Exonic
913208534 1:116564148-116564170 TCAAAGTTCCACGTATCTTTAGG + Intronic
914667909 1:149847375-149847397 TTAGACTTCAACATATCTTTCGG - Intronic
915793793 1:158704734-158704756 TGAGATTTCCAGTTATCTTTCGG - Intergenic
919200225 1:194347250-194347272 TTAGATTGACACCTATCTTAGGG + Intergenic
1063215219 10:3918981-3919003 TTAGTTGACCACATATATTTAGG + Intergenic
1067816395 10:49480636-49480658 TGAGATTACCACTTCTCCTTTGG - Intronic
1070216459 10:74387254-74387276 TTAGATTACTACATTCCTTTTGG + Intronic
1070701340 10:78603819-78603841 CAAGATTCCCATGTATCTTTTGG + Intergenic
1076303742 10:129448280-129448302 ATAGCTTTCCACGTATTTTTTGG - Intergenic
1086726614 11:90193382-90193404 GTAGATCACTACGTATCTCTGGG + Intergenic
1086968647 11:93056690-93056712 ATAGATAAACATGTATCTTTGGG + Intergenic
1087033568 11:93731744-93731766 TTAACTTACCAAGAATCTTTGGG + Intronic
1090302058 11:125651053-125651075 TTAGATTCCCAGGTATATGTTGG + Intronic
1094632955 12:32195472-32195494 TTAGATGACCATATATGTTTGGG - Intronic
1095422018 12:42033980-42034002 TTAGAATACCATGAATCATTTGG - Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1102832735 12:116020482-116020504 TTTGATTACCACAGATGTTTAGG - Intronic
1109517249 13:63459860-63459882 TTTGATTACCAAATCTCTTTGGG - Intergenic
1110289935 13:73793760-73793782 TTAGATTCACATGTATCTGTTGG - Intronic
1111340214 13:86875250-86875272 TTATATTCCCAAGTTTCTTTGGG - Intergenic
1112094996 13:96122892-96122914 TTAGATTGCCAAATAGCTTTGGG + Intronic
1113502842 13:110791957-110791979 TTAGATAATCAGCTATCTTTTGG + Intergenic
1114398861 14:22391182-22391204 CTAGATCACCACTTATCTTATGG - Intergenic
1116646475 14:47535351-47535373 TTAGGTTAACACCTAACTTTGGG + Intronic
1118433220 14:65743581-65743603 TGAGAGTACCAGGTATCTTTGGG + Exonic
1127848759 15:62894943-62894965 TGAGACTTCAACGTATCTTTTGG + Intergenic
1140169439 16:72588051-72588073 TTAGATTATTACATATCCTTGGG + Intergenic
1146827721 17:36037872-36037894 TTCGATTTCTTCGTATCTTTGGG + Intergenic
1147301543 17:39532523-39532545 TTACATTTCCATGTATCTTCAGG - Exonic
1155319272 18:24603115-24603137 ATAGATTACCACCTATTTTAGGG + Intergenic
1156186034 18:34664721-34664743 TTAGCTTGCCAAGTAGCTTTGGG + Intronic
1160337182 18:78053147-78053169 TTAGACTTCCATTTATCTTTTGG + Intergenic
1164256229 19:23530603-23530625 TTAGATTATAATATATCTTTGGG - Intronic
1164283259 19:23787951-23787973 TTAGATTGCAATATATCTTTGGG + Intronic
924995317 2:355685-355707 TTAGGTTACCACTTTTCTTCTGG + Intergenic
925312274 2:2893464-2893486 TTACATTAGCAAGTATCTTTTGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
939737991 2:145873289-145873311 CTAGATTTCCACCTATCTTCTGG - Intergenic
944564618 2:200976346-200976368 TTGGATTACAAAGTATGTTTTGG - Exonic
1170549516 20:17464788-17464810 TTAGTTTACTCCCTATCTTTTGG + Intronic
1177712891 21:24803255-24803277 TTAGATTACATCTTATCATTTGG + Intergenic
1177839985 21:26224915-26224937 TTAGTTTCCCACGTATGGTTAGG + Intergenic
1178254535 21:31040238-31040260 GTAGATTACCACCTTTCTTGGGG - Intergenic
1181179325 22:21055869-21055891 TCACATTCCCACGTGTCTTTGGG - Intronic
951148496 3:19258152-19258174 TTAGACTGCAACATATCTTTTGG + Intronic
952581562 3:34839118-34839140 TAAGATTTCAACATATCTTTTGG + Intergenic
956706202 3:72001266-72001288 TTAGCTTAACATGTTTCTTTAGG - Intergenic
957114567 3:76008869-76008891 ATAGATTTCCCCGTTTCTTTGGG - Intronic
957749739 3:84398676-84398698 TCAGATTTCAACCTATCTTTTGG + Intergenic
957987550 3:87590790-87590812 TCAAAGTTCCACGTATCTTTAGG + Intergenic
960295694 3:115940705-115940727 TTAGTTAACCACATATGTTTGGG + Intronic
962303067 3:134260622-134260644 ATATCTTTCCACGTATCTTTTGG + Intergenic
963840288 3:150097852-150097874 TTAAATTTCCACGTAAATTTTGG - Intergenic
963881071 3:150529133-150529155 GTAGCTTACCATGTAGCTTTTGG - Intergenic
967460247 3:189738050-189738072 TTGGATTAGCAAGGATCTTTTGG - Intronic
971774182 4:30939584-30939606 TTACATTACCAAGTATTTTATGG - Intronic
980837827 4:138218781-138218803 TTAGATTACCATTTACCTTCTGG + Intronic
987548285 5:19342439-19342461 TCAGATTACATTGTATCTTTTGG + Intergenic
991360970 5:65819529-65819551 GAAGATTAGCATGTATCTTTTGG - Intronic
993540122 5:89138850-89138872 TTAGAATACCTTGTATATTTGGG + Intergenic
993664299 5:90676391-90676413 TTATATTACCACATATATTATGG - Intronic
995225662 5:109697915-109697937 ATAGATTTCCAGGTATCCTTGGG + Intronic
996922853 5:128789211-128789233 TTAGATTAACACCTATGGTTGGG + Intronic
1006017667 6:31095110-31095132 TAAGATTTCAGCGTATCTTTTGG + Intergenic
1012543852 6:100394399-100394421 TTTGCTTTCCACGTATTTTTTGG + Intronic
1012585540 6:100917343-100917365 TTAAATAACCTAGTATCTTTAGG - Intergenic
1015070254 6:129085134-129085156 TTAGAAAACAACATATCTTTAGG - Intronic
1015900721 6:138062974-138062996 TAAGATGACAACATATCTTTTGG + Intergenic
1020510867 7:9055355-9055377 TTAGTTGACCACGTATGTGTGGG + Intergenic
1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG + Intronic
1022411286 7:30140250-30140272 TTAGAGTCCAACGTGTCTTTGGG - Intronic
1022740507 7:33115687-33115709 TTAGAATAACTCTTATCTTTTGG + Intergenic
1023185365 7:37527389-37527411 TTAGATTGCCCCGTGTCCTTAGG - Intergenic
1026075316 7:67161447-67161469 TTAGATTACCACGTATCTTTTGG + Intronic
1026701534 7:72650756-72650778 TTAGATTACCACGTATCTTTTGG - Intronic
1028659580 7:93254198-93254220 TTAGATTAGTAAGTACCTTTAGG + Intronic
1030412724 7:109202037-109202059 ATAGATTACCAAATATCTTGGGG + Intergenic
1031280247 7:119790739-119790761 TTACATTACCACATGGCTTTTGG + Intergenic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1037231373 8:16662819-16662841 TTAACTTACCAAGTATTTTTGGG - Intergenic
1044310974 8:90692024-90692046 TTAGATTACCAGTTACCCTTGGG + Intronic
1047693136 8:127376994-127377016 TAAGATTTCAACATATCTTTTGG - Intergenic
1048985586 8:139733066-139733088 TCACATTCTCACGTATCTTTTGG - Intronic
1052221865 9:26033921-26033943 TAAGATAACCACATATGTTTTGG + Intergenic
1055533564 9:77212629-77212651 TTAGATTTGCAGGTATCATTGGG - Intronic
1055533647 9:77213797-77213819 TTAGATTTGCAGGTATCATTGGG - Intronic
1055707491 9:79022306-79022328 GTAGATTATCACGTATCATCTGG - Intergenic
1186606306 X:11096325-11096347 TTTGATTATCATGTCTCTTTGGG - Intergenic
1188545142 X:31297211-31297233 TTAGTTTACCACTAAACTTTGGG - Intronic
1189999754 X:46674658-46674680 TTCGATTCCCACTTCTCTTTGGG + Intronic
1190202038 X:48370276-48370298 TTGGAATACCTCTTATCTTTTGG + Intergenic
1190208500 X:48425137-48425159 TTGGAATACCTCTTATCTTTTGG - Intergenic
1190668886 X:52720886-52720908 TTGGAATACCACTTATCTTTTGG + Intergenic
1190670531 X:52737518-52737540 TTGGAATACCACTTATCTTTTGG - Intergenic
1192593303 X:72380118-72380140 TTAGATTCCCAGGTATTTGTTGG + Intronic
1193390181 X:80917146-80917168 TTAGTTGACCACATATGTTTGGG - Intergenic
1196934568 X:120716776-120716798 TTAGAATACCACGTAGCTCTGGG - Intergenic
1196961159 X:121003574-121003596 TTAGAATAACTCTTATCTTTTGG - Intergenic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1198152966 X:133929242-133929264 TTAGTTGACCACATATGTTTGGG + Intronic
1198265810 X:135007532-135007554 TTAGATCACCTACTATCTTTAGG + Intergenic
1198894307 X:141435099-141435121 TTCTATTACTACATATCTTTGGG - Intergenic