ID: 1026076809

View in Genome Browser
Species Human (GRCh38)
Location 7:67179167-67179189
Sequence GGGCAGGCCAATGCAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 2, 1: 0, 2: 4, 3: 15, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026076804_1026076809 19 Left 1026076804 7:67179125-67179147 CCTGGCAACTGTATTTATGCACA 0: 2
1: 0
2: 0
3: 14
4: 113
Right 1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG 0: 2
1: 0
2: 4
3: 15
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026076809 Original CRISPR GGGCAGGCCAATGCAAATAA AGG Intronic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
914719899 1:150281394-150281416 GGGCAGCCCAATTCTAATTAGGG - Intergenic
918439917 1:184556460-184556482 GGCCAGGCCAAGCCAAAGAATGG + Intronic
918699583 1:187591104-187591126 GGTGAGCCCTATGCAAATAAAGG - Intergenic
922500009 1:226090027-226090049 GGGGAGGGCAATTCAAACAAAGG + Intergenic
923260644 1:232264692-232264714 GGCCAGGCCAATGGAAGGAATGG - Intergenic
924813423 1:247422899-247422921 GGGCAGGCAAAAGCAAACGAGGG + Intronic
1066444058 10:35465683-35465705 GGACAGGCCAAAGCACATAACGG - Intronic
1071802056 10:89074372-89074394 GGGCAGGAAACAGCAAATAAAGG + Intergenic
1072837822 10:98735641-98735663 GGTCACGCCAATGCAAAAGATGG - Intronic
1075838825 10:125479640-125479662 GAGCAGGCCAATGGGAAGAATGG + Intergenic
1076996756 11:300857-300879 AGGCAGGACAATGCAAAGCAAGG + Intergenic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080087938 11:28309065-28309087 GAGCAGGCCACTACAAATGAGGG - Intronic
1080313322 11:30920179-30920201 GGGCATGGGAATGCAAATGAGGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080587546 11:33695317-33695339 AGGCAGGCCAAGTAAAATAAAGG - Intergenic
1080788161 11:35494683-35494705 GGGCAGGGCAATGCATTTATAGG - Intronic
1088234137 11:107704398-107704420 GGGCAGCTCAATGCCAATACAGG + Intergenic
1089918070 11:122178808-122178830 GGAGTGGCCAAGGCAAATAAGGG + Intergenic
1092918365 12:13208511-13208533 GGGAAGGCCATTGAAAATAATGG + Intronic
1093514586 12:19971480-19971502 GGGCAGGGCAAAGCACATGACGG + Intergenic
1095707034 12:45248299-45248321 GGGCAGGGCAATGGAAGTACAGG - Intronic
1096009317 12:48199462-48199484 GGGCAGGCAAGAACAAATAATGG - Intergenic
1101390584 12:104296233-104296255 GGTCAGGCCCATGCAAATCTTGG + Intronic
1101987073 12:109455719-109455741 GGGCAGGCAAATTCAATTAAGGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1110117308 13:71835238-71835260 GAGCTTGCCAAGGCAAATAAAGG + Intronic
1112568537 13:100572050-100572072 GTGCAGACCAATGCAGAGAAGGG - Intronic
1112864093 13:103872279-103872301 GGGCATGCCAGTGCAAACAGTGG + Intergenic
1114166529 14:20224310-20224332 ATGCAGGCCAGTGCAAACAATGG - Exonic
1114501687 14:23174103-23174125 TGGCATGCCGATGCAAATCATGG + Intronic
1115301838 14:31893633-31893655 CTGCAGGCCAATGCAAATAAAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117916873 14:60687090-60687112 GGACAGGCCAAAGCAAACAAGGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1122793978 14:104196577-104196599 GGACAGGCCAAGGCAAGGAAGGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1125310839 15:38376562-38376584 GGACAGGCCACAGCACATAACGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133681546 16:8124723-8124745 GGCTAGGCCCATGCAAACAATGG + Intergenic
1134203203 16:12215856-12215878 GGGCAGCCAGATGCAAATGAGGG - Intronic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138335938 16:56252847-56252869 GGACAGGCCAATGCACTCAAGGG - Intronic
1143052977 17:4142169-4142191 GGACAGGACAATACAAAAAATGG + Intronic
1144076825 17:11727105-11727127 TGCCAGGGAAATGCAAATAATGG - Intronic
1145747435 17:27330848-27330870 GGGCAGGACAATTCAAAGTAGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146138076 17:30340694-30340716 GAACAGGCCTATGCAAATGAGGG - Intergenic
1148348855 17:46923820-46923842 GTGCAGGACGATGCGAATAAAGG - Intronic
1152035536 17:77869956-77869978 GGGGAGCTAAATGCAAATAAGGG - Intergenic
1155583894 18:27343014-27343036 GGGTAGGCCAATGGTAATCATGG - Intergenic
1159243445 18:65774415-65774437 GGGTAAGCAAAAGCAAATAATGG - Intronic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
925661706 2:6209672-6209694 GGGCATGCCAATCCAAGGAATGG - Intergenic
925966213 2:9068920-9068942 GGGCTGTACAATGCAAAAAATGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
935513640 2:104006721-104006743 GCGTATGCAAATGCAAATAATGG - Intergenic
940343209 2:152602447-152602469 GGGCAGTCCAGTGCACAGAAGGG + Intronic
948583008 2:239000690-239000712 GGGGAGGGGAATGCAAATCAGGG - Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1170036133 20:11992184-11992206 GGGAAGGCCAAGGCAAATGGGGG - Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1174328552 20:49799167-49799189 GCCCAGGCCAATGCATAGAATGG + Intergenic
1175425706 20:58864646-58864668 GGGCTGGCAAAGGCAAAGAAGGG + Intronic
1177942142 21:27424310-27424332 GGGCTGGACAAAGCACATAAAGG + Intergenic
949263974 3:2135659-2135681 GGGCTGGTCAATGCAGATGAAGG + Intronic
951419235 3:22464201-22464223 GGGAAGGGGAGTGCAAATAATGG + Intergenic
952013172 3:28925963-28925985 GAGCAGGTCAATGAAAATAGAGG - Intergenic
953261157 3:41340309-41340331 GGCCAAGCTAATGCAAATACAGG + Intronic
953897214 3:46811877-46811899 GGGCAGGTCAATGAAAGGAAGGG + Intronic
954314352 3:49793103-49793125 GGGCAGGCCAAGGCCAGCAATGG - Intronic
954329882 3:49884258-49884280 GGGCAAGCAGATGCTAATAAAGG - Intergenic
955986265 3:64576884-64576906 TGGCAGGGCCAGGCAAATAAAGG + Intronic
957471000 3:80657237-80657259 GGGAAGTCCAAGGGAAATAAAGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
962975192 3:140440109-140440131 GGTGAGGCCAATACCAATAAGGG + Intronic
965771886 3:172190195-172190217 GGGCAGCCCTACGCAAATAGGGG + Intronic
970052962 4:11936978-11937000 GGGCAGGACCATGGTAATAAGGG + Intergenic
972304485 4:37819058-37819080 GGGGAGGGCAATGCAGATATAGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976453585 4:85219795-85219817 GGGCAGACTAATGCAAGAAATGG - Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
983933284 4:173476391-173476413 GGGTAGGCAGATGGAAATAAAGG + Intergenic
984230742 4:177095819-177095841 AGGCAAACAAATGCAAATAATGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
985820550 5:2157288-2157310 GGGCAGGTGAATGGATATAAGGG - Intergenic
987300844 5:16597087-16597109 AGGCTGGCAAATGCATATAATGG + Intronic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
989307074 5:39970545-39970567 GAAAAGGCCAATGCAAATAAGGG - Intergenic
992538896 5:77742070-77742092 CCACAGGCCAAAGCAAATAAAGG + Intronic
994898074 5:105731116-105731138 GGGCAGGCCACTGGGGATAAAGG + Intergenic
996180695 5:120416166-120416188 GGGCATACCAATGCACTTAATGG - Intergenic
999497713 5:152116432-152116454 GGGAAGGCCTATGCAACTGATGG + Intergenic
1003861270 6:10323999-10324021 GTACAGGCCAACACAAATAAGGG + Intergenic
1003933094 6:10946462-10946484 GGGTAGGCCAATGGAATTCAAGG - Intronic
1004124479 6:12859187-12859209 GGGTAAGCCAATGAAAATAATGG + Intronic
1004961616 6:20796674-20796696 GGTCAGACCCATGCAAATATGGG + Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011814548 6:91173262-91173284 GGGCAGCCCAAAGAAAAGAAAGG + Intergenic
1015410309 6:132886485-132886507 GGGCAGGCCAAGGTAAGAAAGGG + Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017562573 6:155644804-155644826 TGACAGGCCAATGAAAATACTGG + Intergenic
1017892778 6:158652949-158652971 GGACAGGGCCGTGCAAATAAAGG + Intronic
1017980418 6:159396160-159396182 TGGCATACCAATGCAAATAGAGG - Intergenic
1018228726 6:161655345-161655367 GGCCAGGCCCATGCTAATGACGG - Intronic
1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG + Intergenic
1019837027 7:3398200-3398222 GGGAAGCCCAAAGAAAATAAAGG - Intronic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1040329280 8:46377710-46377732 GGGCAGGCCACAGCGACTAAGGG + Intergenic
1047322906 8:123805036-123805058 GTATAGGCCAATGCAAAAAAAGG - Intronic
1048165537 8:132058624-132058646 GGGCAGCGAAATGCATATAATGG + Intronic
1049824876 8:144662076-144662098 GAGCAAGCCAAGGCAGATAATGG - Intergenic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1188015416 X:25103033-25103055 GGGGAGGCAACTGTAAATAATGG + Intergenic
1190158218 X:48010750-48010772 GTGCTGGCCATTGCAAAGAATGG - Intronic
1190173989 X:48133632-48133654 GTGCTGGCCATTGCAAAGAATGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1191603706 X:63039553-63039575 GGTCAGGCCGATGCAAAAAGTGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197289463 X:124637773-124637795 GGGGAGGCAAATGTGAATAAAGG - Intronic
1197615102 X:128682012-128682034 GGGCAGGACAATTAAGATAAAGG + Intergenic
1198579268 X:138045828-138045850 GGGTAGGCCTATTAAAATAAAGG - Intergenic
1198660586 X:138964233-138964255 GGGAAAGCCAATGCAAATAAAGG + Intronic