ID: 1026077830

View in Genome Browser
Species Human (GRCh38)
Location 7:67189099-67189121
Sequence CAGGGTAGATAGAAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 2, 1: 0, 2: 5, 3: 43, 4: 545}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026077830_1026077834 6 Left 1026077830 7:67189099-67189121 CCTTCCTTTTTCTATCTACCCTG 0: 2
1: 0
2: 5
3: 43
4: 545
Right 1026077834 7:67189128-67189150 GTTTCTCTTTTGTGAGTCAAAGG 0: 2
1: 0
2: 4
3: 18
4: 232
1026077830_1026077835 26 Left 1026077830 7:67189099-67189121 CCTTCCTTTTTCTATCTACCCTG 0: 2
1: 0
2: 5
3: 43
4: 545
Right 1026077835 7:67189148-67189170 AGGAAAAATCATCTTAACTTTGG 0: 2
1: 0
2: 2
3: 41
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026077830 Original CRISPR CAGGGTAGATAGAAAAAGGA AGG (reversed) Intronic
900863126 1:5246653-5246675 GAGGGAAGGAAGAAAAAGGAAGG - Intergenic
901903261 1:12385447-12385469 CAGGATAGAAAGAAAACAGAAGG - Intronic
903596476 1:24499421-24499443 CAGGGTTGAGGGAAAAAGCAGGG + Intergenic
903747733 1:25599686-25599708 AAAGAAAGATAGAAAAAGGAAGG + Intergenic
903991623 1:27274886-27274908 CATGGTAGAGAGAAGAAGAAAGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904146238 1:28394326-28394348 CAGAGCAGAGAGAGAAAGGAAGG + Intronic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
906628906 1:47348191-47348213 CAGGTAAGAGAGAGAAAGGATGG + Intronic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907726529 1:57025448-57025470 GAGGGAAGAAACAAAAAGGAGGG + Intronic
908742953 1:67347656-67347678 CAGAGCAGAAAGAAAATGGAAGG + Intronic
909181057 1:72424619-72424641 GAGGGTAGAAGGAAGAAGGAGGG + Intergenic
909896465 1:81077014-81077036 GTGAGTAGATAGAAAAATGATGG - Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910620287 1:89246031-89246053 CAGGGTAAATAACAAAATGAAGG + Intergenic
910649405 1:89549324-89549346 CAGGGTTAATAGAAACATGAAGG - Intronic
912014379 1:105014360-105014382 CAGAGAAGGTAGAAAAAGAAGGG - Intergenic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
912567237 1:110596842-110596864 CAAGGTAGATCAAAAAAGGATGG + Intronic
912705221 1:111906643-111906665 CAGGGTAGAGAGGAAAAGCAAGG - Intronic
913537127 1:119783815-119783837 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
913933573 1:125010475-125010497 CTGGGTACATAAAAAAATGAAGG + Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
915453491 1:156023333-156023355 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
915465929 1:156097893-156097915 CAGGGCAGAGAGAAAACGGTGGG - Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
916078306 1:161216020-161216042 CAGGGTTGATAGAAAGTGGCAGG + Intronic
916787529 1:168097225-168097247 CATAGTAGCTAGAAAAGGGATGG + Exonic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917655600 1:177122520-177122542 TAGGGAAGAGAGAAAAGGGAGGG - Intronic
918088307 1:181263983-181264005 CAGGCTAGCTAGAGAAAGCAGGG + Intergenic
918212420 1:182362874-182362896 CAGAGAAGATAGAAATAGCAGGG - Intergenic
918879720 1:190101548-190101570 AAAGGAAGAAAGAAAAAGGAAGG - Intronic
919117545 1:193299017-193299039 AAGGGTAGAAATAAAAATGATGG - Intergenic
919421330 1:197373665-197373687 GAAGGTAGATACAGAAAGGAGGG + Intronic
919545656 1:198914957-198914979 CAGGGTAGCTAGCAGTAGGAGGG - Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920863423 1:209730913-209730935 AAGAGCAGATAGAAAATGGAGGG + Intronic
921343487 1:214157813-214157835 CAGGGAAGAAAGATAAAGAAAGG + Intergenic
921572952 1:216800371-216800393 CAGGCTGGACAGAAAAGGGAGGG + Intronic
922251233 1:223850364-223850386 CAGGGCAGAGTGAACAAGGAGGG + Intergenic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
922936493 1:229426818-229426840 CAGGGCAGAAAGGAAATGGAAGG + Intergenic
924191851 1:241561739-241561761 CAAGGTAGGGAGAGAAAGGAAGG - Intronic
924600080 1:245480965-245480987 CACTGTAGAGAGAAATAGGAAGG - Intronic
924863085 1:247947002-247947024 TAGGGAAGATAGAAAAATGAGGG - Intronic
1063197835 10:3759675-3759697 CAGGAAAGGAAGAAAAAGGAAGG + Intergenic
1063918889 10:10912251-10912273 CGGGGTAGAAAGTAAAAGCAGGG - Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065009992 10:21412291-21412313 CAGGGTGGATAGCAGAAGGTGGG - Intergenic
1065055625 10:21839001-21839023 CTGGGTAAATAAAGAAAGGAAGG + Intronic
1065923869 10:30418170-30418192 GAGGGAAGAAAGAGAAAGGAAGG + Intergenic
1067052542 10:43030310-43030332 CAGGCTAGACAGACAAGGGATGG + Intergenic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068462482 10:57345613-57345635 CAGGGTAGAGGGTAAAAGGAGGG - Intergenic
1069108338 10:64411075-64411097 CAAGGCAGCTAGAAAAAGCAGGG - Intergenic
1069404108 10:68079687-68079709 CAGGATAGATAGAAACATGGGGG + Intergenic
1070223510 10:74475800-74475822 AAGAGAAGAGAGAAAAAGGAGGG + Intronic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1070828058 10:79402579-79402601 CATGGAAGATAGAAAAACCAAGG - Intronic
1071530522 10:86387819-86387841 TAGGGGAGATAGGAGAAGGAGGG - Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073667804 10:105552967-105552989 CTGGGTACATAAAAAAATGAAGG + Intergenic
1075754347 10:124799276-124799298 CGGGGTAGATGAAAAAAGGGAGG - Intergenic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1077826141 11:5809839-5809861 CTGGGTAAATAACAAAAGGAAGG - Intronic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1078975064 11:16464479-16464501 GAGGGGAGAAAGGAAAAGGAAGG + Intronic
1079265162 11:18924025-18924047 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1079637960 11:22769053-22769075 CAGGGTTAATAGAAAAAGTATGG + Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1079946414 11:26747750-26747772 CAGAGTGGATAGAAAAAATAAGG - Intergenic
1079958324 11:26891169-26891191 AATTGTAGATAGTAAAAGGAAGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080268523 11:30425859-30425881 CAGGTTTGAAAGAAAAAGGGAGG + Intronic
1080515566 11:33016258-33016280 CTGGGTAGAAAGAAAAAAGCTGG - Intronic
1081181123 11:39986950-39986972 CTGGGTATATAAAAAAATGAAGG + Intergenic
1081329368 11:41785345-41785367 CATGGTAGAGAGAAAAGGGTTGG + Intergenic
1082147664 11:48689817-48689839 CAGGATAGATAGAAACTAGAAGG + Intergenic
1082578082 11:54834046-54834068 CTGGGTACATAAAAAAATGAAGG + Intergenic
1082589788 11:54991827-54991849 CAGGATAGATAGAAACTAGAAGG + Intergenic
1082650002 11:55777750-55777772 AAGGGTAGATGGTTAAAGGAGGG + Intergenic
1082651528 11:55799846-55799868 CAGGTTATGGAGAAAAAGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083255130 11:61490947-61490969 CAGGGTGGCTGGAAAAAGGAGGG + Intergenic
1083575826 11:63790569-63790591 AAAGGAAGAAAGAAAAAGGAAGG + Intergenic
1084852723 11:71955892-71955914 CAGTGTGGGTAGGAAAAGGAAGG + Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085443153 11:76581111-76581133 CAGGGTATAAAGAAAAACGGTGG - Intergenic
1085451100 11:76633949-76633971 CTCTGTAGCTAGAAAAAGGAAGG - Intergenic
1086180005 11:83939415-83939437 CAGTGTAGAGAAAAAAAGCAAGG + Intronic
1086199065 11:84178505-84178527 CACAGGAGATAGGAAAAGGAAGG + Intronic
1086442325 11:86840861-86840883 CTGGGTAAATAGCAAAATGATGG + Intronic
1086918052 11:92554154-92554176 CAGGGAAGAAAGAAAATGAATGG + Intronic
1087517806 11:99186922-99186944 CAAAGTAGATAGAGAAATGAGGG + Intronic
1087828649 11:102794697-102794719 CAGGGGAGATAATTAAAGGATGG + Intronic
1087846329 11:102977663-102977685 CAGGGTAGGTAGAAATAGAAAGG - Intergenic
1088642206 11:111883746-111883768 GAGGGAAGAAAAAAAAAGGAAGG - Intronic
1088649148 11:111942113-111942135 CAGGCAGGATAGAAAAAAGAAGG - Intronic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090477190 11:127034023-127034045 CAGGATAGATAGACAATGGGGGG - Intergenic
1090625361 11:128603616-128603638 CAGGCCAGAAAGAAAAAGAAAGG + Intergenic
1091089742 11:132760038-132760060 CTGGGTAGATAAAAAAATTAAGG - Intronic
1091436476 12:477243-477265 TAGGGCAGTTAGAAAAAGAAAGG - Intronic
1091515015 12:1170616-1170638 CTGACTAGATAGAAAAAGAAGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093626616 12:21356490-21356512 AAAGGGAGAGAGAAAAAGGAAGG + Intronic
1093635642 12:21464053-21464075 CAGGTTAGAAACAAAAAGGCTGG - Intronic
1093847439 12:23990087-23990109 GAGTGAAGATATAAAAAGGAAGG + Intergenic
1094086679 12:26600877-26600899 CAAGGTAAATAGCAAAAGGAAGG - Intronic
1094091026 12:26650159-26650181 GAGGGCAGATATAAACAGGACGG + Intronic
1094132330 12:27087520-27087542 GAAGGAAGAAAGAAAAAGGAAGG - Intergenic
1094331674 12:29301029-29301051 CAGGATGGATAGAAAATGGGGGG - Intronic
1096089829 12:48891391-48891413 GCGGGTAGAGAGATAAAGGAAGG + Intergenic
1096324518 12:50647471-50647493 CAGGGTGGAGAGGAAAAGGAGGG - Intronic
1096743100 12:53708919-53708941 TAGGGTAGATGGGAAATGGAAGG + Intronic
1096830880 12:54313165-54313187 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1096855039 12:54474760-54474782 AAGGTTAGACAAAAAAAGGAAGG + Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097571520 12:61338784-61338806 CAGAGTAGAAAGGAATAGGAGGG + Intergenic
1100254167 12:92865309-92865331 GAGGATAGCTAGAGAAAGGAAGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101648275 12:106651696-106651718 CAGGGTACAAAGAAATAGGGAGG + Intronic
1102601107 12:114031299-114031321 CAGGGCAGAAGGGAAAAGGAAGG - Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103032295 12:117626445-117626467 CTGGGTAGATAACAAAATGAAGG - Intronic
1103154406 12:118671813-118671835 CTGGGTAAATAAAGAAAGGAAGG - Intergenic
1103848547 12:123916237-123916259 CAGGGTAGAGAGGAAAGGAAGGG - Intronic
1104349660 12:128033978-128034000 CATGGTAGATTAAGAAAGGAGGG - Intergenic
1104547734 12:129727333-129727355 CAAGGTGGAGAGAAAAATGAGGG + Intronic
1105552636 13:21411721-21411743 TAGGGTAGCTAGAAGAATGACGG + Intronic
1105571342 13:21605635-21605657 CAGGCTAGATACAAAAAAGCAGG - Intergenic
1107896992 13:44975190-44975212 CAGGGTAGAGTGAAAAGAGAAGG - Intronic
1108158156 13:47609785-47609807 CTGGGTATATATAAAAAGAAAGG + Intergenic
1109655002 13:65378613-65378635 CTGGGGAGATAAAAAAAGGCTGG - Intergenic
1110055627 13:70967093-70967115 AAGGGGAGAGAGAAAAAGAAAGG - Intergenic
1110085708 13:71376714-71376736 CAGGAAAGATAGAAAATAGAAGG - Intergenic
1110215018 13:73015354-73015376 CAGAATAGAAAGAAAAAGGCAGG - Intronic
1110392343 13:74989097-74989119 CAGGGTTGATACAAAAAGAATGG + Intergenic
1111386960 13:87539865-87539887 CAGGGGAGATAAAAACACGAAGG + Intergenic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1113107731 13:106789565-106789587 CAGGGTAGAGAGTGACAGGAAGG - Intergenic
1115496120 14:34006431-34006453 TAGGGGAGATAAAAAAATGAAGG + Intronic
1116020535 14:39454918-39454940 CAGGAGAGAGAGAGAAAGGAAGG + Intergenic
1116805406 14:49489552-49489574 GAGGGAAGAAAGAGAAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116934101 14:50719794-50719816 CAGGGTATATAGAAAACAAAAGG + Intronic
1117007241 14:51433665-51433687 GAGGGTAGATGGAAACAGGGTGG + Intergenic
1117866996 14:60160431-60160453 AAGGGAAAATAGAAATAGGATGG + Intronic
1118088448 14:62445511-62445533 CAGAGTAATAAGAAAAAGGAGGG - Intergenic
1118528406 14:66672839-66672861 CAGGGTAGATTAAAAAAATAAGG - Intronic
1118696686 14:68393010-68393032 TAGGGGAAATAGACAAAGGAAGG - Intronic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1119294268 14:73520546-73520568 AAGGGTAGATAGAGAAGAGATGG + Intronic
1120092221 14:80345375-80345397 AAGAGTAGAGAAAAAAAGGAAGG + Intronic
1121497956 14:94410158-94410180 CAGGGAAGACAATAAAAGGAGGG - Intergenic
1121587610 14:95073677-95073699 CTGGGTGGATATAAAAAGGAAGG - Intergenic
1121599613 14:95193511-95193533 TAGGGTAGTTAGCAAAGGGACGG - Intronic
1121703821 14:95976212-95976234 CAGGGTACAAAGAAATAGTAAGG - Intergenic
1122721709 14:103725972-103725994 AAAGGTAGACAGAAACAGGAAGG - Intronic
1123975489 15:25550029-25550051 AAGGGTAAATTGACAAAGGAGGG + Intergenic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1125329722 15:38570849-38570871 CTGGGTAAATAAAAAAATGAAGG - Intergenic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1126425572 15:48523842-48523864 CAGGGCAGATTTAAAATGGAAGG - Intronic
1126490153 15:49228008-49228030 AAGTGTAGATAGAAAAAGACTGG - Intronic
1127653876 15:61037028-61037050 CAGGGTAGATAGCTTAAGAATGG + Intronic
1127803171 15:62494923-62494945 CCGGGAACAGAGAAAAAGGAGGG - Intronic
1128665878 15:69538149-69538171 CAGGTCAGATAGAACAAGTAGGG + Intergenic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130297027 15:82654647-82654669 CAGGGTATGTGGAAATAGGAGGG - Intergenic
1131529523 15:93179842-93179864 CAGGGAAGAGGGAGAAAGGATGG + Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1132111188 15:99103343-99103365 TAGGGTCTCTAGAAAAAGGAAGG + Intronic
1132329100 15:100998610-100998632 GTGGGTAGGTAGAAAATGGATGG + Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134596298 16:15498681-15498703 GAGGAAAGAAAGAAAAAGGAAGG + Intronic
1135321992 16:21503203-21503225 CAGGGAGGGAAGAAAAAGGAAGG + Intergenic
1135521417 16:23181636-23181658 AAAGGAAGAAAGAAAAAGGAGGG + Intergenic
1135615902 16:23910821-23910843 CAGGGAAGAGAGAAAAAAAATGG - Intronic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136333463 16:29596315-29596337 CAGGGAGGGAAGAAAAAGGAAGG + Intergenic
1136386475 16:29929601-29929623 CAAAGTCGATATAAAAAGGATGG + Intergenic
1136751127 16:32637197-32637219 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1137579967 16:49627719-49627741 GCGGGTAGATAGAAGATGGATGG - Intronic
1137713522 16:50583575-50583597 CAGGAAAGATAGTAAAATGATGG + Intronic
1138478832 16:57288213-57288235 CAGGGTTGGAAGAACAAGGATGG - Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140694805 16:77522087-77522109 CAGGTGAGATAGAAAAAGGAAGG - Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1141009696 16:80385966-80385988 CAGGGGTCATAGAAAAATGAAGG + Intergenic
1141102937 16:81211232-81211254 CAGGGTACATGGCAAAAGGGCGG - Intergenic
1141308642 16:82891322-82891344 CAGTGCAGATAAAAAGAGGATGG - Intronic
1141899309 16:86980108-86980130 GTAGGTAGAAAGAAAAAGGATGG + Intergenic
1203053261 16_KI270728v1_random:896452-896474 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1143512776 17:7405337-7405359 TAGGGACGATAGAGAAAGGAGGG - Intronic
1144053170 17:11515299-11515321 GAAGGAAGAAAGAAAAAGGAAGG + Intronic
1144766076 17:17733293-17733315 CAGGCCAGAAAGAAAAAGAAAGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146663115 17:34678340-34678362 AAGGGTAGACAGGAAAAAGAAGG - Intergenic
1146954740 17:36930960-36930982 CAGCCCAGAGAGAAAAAGGAGGG - Intergenic
1148085253 17:44990084-44990106 CAGGGAAGAAAGAAAAGGAAGGG - Intergenic
1148444427 17:47728878-47728900 GAGGGTAGATAGTAAAAGAGAGG - Intergenic
1149456045 17:56789446-56789468 CAGGGTACATGGAACAAGGGTGG - Intergenic
1149595607 17:57862852-57862874 CAGGAGAGATAGAGAACGGACGG + Exonic
1150939361 17:69673833-69673855 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
1150984877 17:70184596-70184618 AAGGGAAGAGAAAAAAAGGAAGG - Intergenic
1151052641 17:70995863-70995885 GAGGGAAGATGGAAGAAGGAAGG - Intergenic
1151952961 17:77365359-77365381 CAGGAAGGAAAGAAAAAGGAAGG - Intronic
1153013758 18:565073-565095 CAGAGTAGATTAAAAAAGAAAGG + Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1155022468 18:21909281-21909303 TAGGGTAGATAGAAAGAAGCTGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156259403 18:35430705-35430727 CTGTTTAGAGAGAAAAAGGAAGG - Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1157045651 18:44099445-44099467 CAGGGGAGGTAGGAAAAGCAGGG + Intergenic
1157180806 18:45496444-45496466 CAGGGTAGCTAGAACAAAGCAGG + Intronic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1157659126 18:49423295-49423317 CTGGGTACATAACAAAAGGAAGG + Intronic
1157911050 18:51617657-51617679 CAGGGAAGTTTAAAAAAGGAAGG - Intergenic
1158791628 18:60786720-60786742 CATAGTAGATAAAAAAAGTACGG - Intergenic
1159141858 18:64406304-64406326 CAGGGTAGAAAGCAAAATGCTGG - Intergenic
1159628053 18:70717185-70717207 TTGGGTAGATAACAAAAGGAAGG + Intergenic
1159635213 18:70797125-70797147 CTGGGTACATAACAAAAGGAAGG + Intergenic
1159754742 18:72350530-72350552 GAGGGGAGAAAGAAAAAGGATGG + Intergenic
1159885676 18:73902361-73902383 CAATGTAAATAGAAAAATGATGG - Intergenic
1159980890 18:74778168-74778190 CAGGGAGGATAGAAAAAAGAGGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162310108 19:9901114-9901136 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1164526446 19:29016858-29016880 CAGGGTTGGAAGAAAATGGAGGG + Intergenic
1165355902 19:35303889-35303911 CAGGGGAAATGGAAACAGGAAGG - Intronic
1166446346 19:42860774-42860796 CTGGGTAGATAACAAAATGAAGG - Intronic
1168188603 19:54720585-54720607 CTGGGTATATACCAAAAGGAAGG + Intergenic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
925071889 2:976195-976217 CAAGGTAAATAGAAAAATTATGG + Intronic
925325477 2:3018222-3018244 AAGGGAAGATAGGAAAAGGTTGG + Intergenic
925616468 2:5748683-5748705 CAGGGCAGATGGAGAAAGGGTGG - Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
926828790 2:16937196-16937218 AAGGGAAGAAAGGAAAAGGACGG + Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927333461 2:21892890-21892912 CAGGGTAGAAAGTGAGAGGAGGG - Intergenic
928877967 2:36063420-36063442 CTGGGTACATAGCAAAATGAAGG + Intergenic
929423467 2:41819045-41819067 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
929916727 2:46142666-46142688 AAGGGTAGAAAGCAAAGGGAGGG + Intronic
930152693 2:48074762-48074784 CAGAGGAGAAAGAGAAAGGATGG - Intergenic
930877236 2:56232770-56232792 CAGGGTAGTTATAATAAAGATGG - Intronic
933030666 2:77324902-77324924 CATGGTAGACTGATAAAGGAAGG + Intronic
933498227 2:83078338-83078360 GAGGGTAGATGGTAAAAGAAGGG - Intergenic
933513359 2:83269540-83269562 CAGGGTAGAGGGACAAAGGGAGG - Intergenic
934626776 2:95864826-95864848 CAGGGTAGTTTGAGAAAGAAAGG + Intronic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936731666 2:115388502-115388524 CAGTGGAGATAGAAGAGGGATGG + Intronic
937459488 2:122073606-122073628 CAGGGAAGAGAGAAAAACTAAGG + Intergenic
938702516 2:133892395-133892417 AAGGGTAGAATGGAAAAGGAAGG + Intergenic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939236047 2:139494808-139494830 TAGGGTAGATATAAAATAGAAGG + Intergenic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939987638 2:148846882-148846904 ATGGGTTGAAAGAAAAAGGATGG - Intergenic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941502847 2:166301826-166301848 GAGGGTAAATATAAAAAGAAGGG + Intronic
941877229 2:170446420-170446442 CATGGTAGATAGTACAGGGAGGG - Intronic
942607557 2:177708931-177708953 TAGGGTGGATAGAAACACGAAGG + Intronic
943301344 2:186206395-186206417 CAGGGTAGGAATAAATAGGAAGG - Intergenic
943954645 2:194173437-194173459 CAGGGTAAATAGAGTAAGGTAGG - Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
947654678 2:231816873-231816895 CAGAGGAGATGGAAAAAGGATGG - Intergenic
948161063 2:235824944-235824966 CACTGTTGATAAAAAAAGGAAGG - Intronic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
1169192751 20:3668448-3668470 CAGGGTGGGAAGAAACAGGAAGG + Exonic
1169665904 20:8035381-8035403 TAGAGGAGGTAGAAAAAGGAGGG - Intergenic
1169947436 20:11004235-11004257 CAGGATAAATAGAGAATGGAAGG + Intergenic
1170104515 20:12738916-12738938 CAGGTGAGAGAGAAAAAAGAGGG + Intergenic
1170397676 20:15945825-15945847 CATGGTGGATAGAAAATGCATGG - Intronic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171039654 20:21748912-21748934 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171094082 20:22315134-22315156 CAGGAGAGAGAAAAAAAGGAGGG + Intergenic
1171268238 20:23791352-23791374 CTGGGTAGATAACAAAATGAAGG + Intergenic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171513869 20:25711744-25711766 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1172253502 20:33496809-33496831 CAGGATAGGGTGAAAAAGGATGG - Intronic
1173472216 20:43332813-43332835 CTGGGTAGAAAGGAAAAGAAGGG - Intergenic
1174052246 20:47774875-47774897 AAGGGCAGAAAGAAAAAGCAGGG + Intronic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1175889337 20:62309485-62309507 CAGGGAAGATGGAAGAAGGCTGG + Intronic
1176512972 21:7762541-7762563 AAGTGTAGATAGGAACAGGATGG - Intronic
1177228334 21:18286262-18286284 CAGTGTAGATATAAAAGAGAAGG - Intronic
1177760095 21:25393286-25393308 AGAGGTAGAGAGAAAAAGGAGGG + Intergenic
1177929004 21:27256664-27256686 CAAGAAAAATAGAAAAAGGAAGG - Intergenic
1178089812 21:29150621-29150643 CATGGAGGATAGAAAAAAGAGGG - Intronic
1178481094 21:32979621-32979643 AAGGGGAGATAGAGAAAGAAGGG + Intergenic
1178647085 21:34393065-34393087 AAGTGTAGATAGGAACAGGATGG - Intronic
1179468336 21:41593284-41593306 CAGGGGAGATACCAAAAAGAAGG - Intergenic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1180541275 22:16450115-16450137 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1181885291 22:26017181-26017203 GAAGGAAGAAAGAAAAAGGAAGG - Intronic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182825697 22:33262847-33262869 GAGGGAAGAAAGAAAAAGAAAGG - Intronic
1182957404 22:34439525-34439547 CAGGGTAGAGAGAAAAATGTGGG - Intergenic
1183148977 22:36022389-36022411 CAGAGTAGCTAGAAAATGGGAGG + Intronic
1183728264 22:39601532-39601554 CAGAGGAGAGAGAAAAAGGCTGG + Intronic
1184232580 22:43166593-43166615 CAGGGTCCAAAGAGAAAGGAGGG + Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1185039141 22:48495557-48495579 CAGGGAAGGGAGAACAAGGATGG - Intronic
950153299 3:10704834-10704856 CAGGGGAGATACAAAGAAGATGG + Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
951319171 3:21224269-21224291 AAGGGGAGAATGAAAAAGGAAGG + Intergenic
951471335 3:23059848-23059870 CTGGGTAGATAACAAAATGAAGG - Intergenic
952569252 3:34694510-34694532 CAAGGCAGAAAGAAAAAGAAAGG - Intergenic
952598853 3:35054066-35054088 TAAGGTAGATAGGAAAAGGTAGG + Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
955282690 3:57609136-57609158 CTGGGTACATAGCAAAATGAAGG + Intergenic
955522271 3:59786354-59786376 CCAGGTAGAAAGAAAGAGGAGGG - Intronic
955593740 3:60566001-60566023 CTGGGTACATAAAAAAATGAAGG - Intronic
955731657 3:61993687-61993709 CAAGATAGATATAAAATGGATGG - Intronic
955856419 3:63278266-63278288 CAGGGTAGATACAACAGGGGAGG - Exonic
956795756 3:72717030-72717052 CAGGGGGGATTGTAAAAGGATGG + Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
957568408 3:81914440-81914462 CAGGCAAAATAGAAAAAGAAAGG + Intergenic
960062218 3:113335054-113335076 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
960080443 3:113534579-113534601 CACGCTAGATAGAAAGAGGCTGG - Intronic
960119446 3:113932379-113932401 CAGGATAGGTAGAAAAGGTATGG + Intronic
960367278 3:116788050-116788072 CAGGCTTGGTAAAAAAAGGAGGG - Intronic
960569611 3:119172945-119172967 CAGGGAAGAAGGAAAAAAGAAGG + Intronic
961018701 3:123486298-123486320 CAGGGGAGACAGAGAAAGGTTGG + Intergenic
961226863 3:125257695-125257717 GAGGGTAGAGAGAAATGGGAAGG - Intronic
963025559 3:140915473-140915495 CAGGGAAGAAAGAAAAGTGAAGG - Intergenic
963472283 3:145755250-145755272 CAGACTGGATAGAAAAAGGTTGG - Intergenic
964196024 3:154065916-154065938 CAGGGAAGATTGAAAAACGTTGG - Intergenic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964694692 3:159494003-159494025 CTGGGTACATAAAAAAATGAAGG + Intronic
964883683 3:161454287-161454309 CAGGGGAGATAGGAAAAGGTTGG - Intergenic
964899644 3:161642793-161642815 CAAGATAGAAAGAAAAAAGATGG - Intergenic
965179196 3:165379380-165379402 GAGGGTAGAGAGAGAAAGGAAGG - Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966827354 3:183976206-183976228 AAGAGAAGAAAGAAAAAGGAAGG - Intronic
967078046 3:186022548-186022570 CAGGTTGGTTAGAAAAAGCATGG + Intergenic
967215122 3:187203267-187203289 CAGGGTAGCTACAGAAATGAGGG - Intergenic
967691083 3:192474583-192474605 AAAGGTATAAAGAAAAAGGAAGG + Intronic
968037638 3:195561544-195561566 AAGGGTAGCCAGAAAAAGGGGGG - Intergenic
969287643 4:6214704-6214726 CAGGTTGAATTGAAAAAGGATGG - Intergenic
969702002 4:8772916-8772938 CAGGGGAACTAGAATAAGGAAGG - Intergenic
970083201 4:12314083-12314105 CAGGGTAGAAAGTGGAAGGAGGG + Intergenic
970932694 4:21531376-21531398 CAAGAAAGAAAGAAAAAGGAAGG - Intronic
971036433 4:22698023-22698045 CATGGTACAATGAAAAAGGAGGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971748494 4:30615270-30615292 CAGGGTACATGGTAAAAAGAGGG + Intergenic
973137436 4:46725502-46725524 CTGGGTAGATAACAAAATGAAGG - Intergenic
973877416 4:55233858-55233880 CTGGGTAGATAACAAAATGAAGG - Intergenic
973969725 4:56200347-56200369 CAGATTAGAAAGAAAAAGAATGG + Intronic
974148220 4:57972465-57972487 GAGGGTAAATGGTAAAAGGAGGG - Intergenic
974367844 4:60975289-60975311 CTGGGTACATAGAAAAATGAAGG - Intergenic
975187605 4:71421737-71421759 CTGGGTACATAACAAAAGGAAGG + Intronic
975190876 4:71460647-71460669 CAGGGGAAATAAAAAAATGAGGG + Intronic
975729597 4:77324855-77324877 CTGGGTACATAACAAAAGGAAGG - Intronic
975821380 4:78274555-78274577 CAGGGTACATAACAAAATGAAGG - Intronic
976947298 4:90786143-90786165 CTGGGCAGATAGAAAGACGATGG + Intronic
976977020 4:91178051-91178073 CTGGGTACATAACAAAAGGAAGG - Intronic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
978162627 4:105567041-105567063 GAAGATAGATAGTAAAAGGATGG - Intronic
978544437 4:109855780-109855802 CAGGGTACATAACAAAATGAAGG - Intronic
979055096 4:115983720-115983742 GAGTTTAGGTAGAAAAAGGAAGG - Intergenic
979115550 4:116817957-116817979 CTGGGTAAATAAAAAAATGAAGG + Intergenic
979694402 4:123596249-123596271 AAAGGAAGAAAGAAAAAGGAAGG + Intergenic
979713240 4:123805398-123805420 CATGCTAGAAAGATAAAGGATGG + Intergenic
980962773 4:139492799-139492821 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
981249621 4:142584056-142584078 CAGGGCATATAGAATAAGAAGGG - Intronic
981266833 4:142794379-142794401 AAAGGTCGGTAGAAAAAGGATGG + Intronic
981496175 4:145396156-145396178 CAATGTAGTTAGAGAAAGGAAGG + Intergenic
982861224 4:160451847-160451869 CATGGTAGAGACAGAAAGGAAGG + Intergenic
983594567 4:169451537-169451559 CTGGGTAAATAAAAAAATGAAGG + Intronic
983921474 4:173350303-173350325 CAGAGGTGAAAGAAAAAGGATGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
986862002 5:11937236-11937258 CAGGGTAGAAAGAATAAGACAGG - Intergenic
986941102 5:12951018-12951040 CAGGGTATTTTGAAATAGGAAGG - Intergenic
987701027 5:21398502-21398524 CAGGGTAGATGCATATAGGAAGG - Intergenic
988102693 5:26702340-26702362 CAGGGTAGATGGATATACGATGG - Intergenic
988381027 5:30497065-30497087 CAGGGTAAATAACAAAATGAAGG - Intergenic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
989432488 5:41372057-41372079 GGGGGTAGAGAGAATAAGGATGG - Intronic
990135244 5:52636986-52637008 CATGGAAGATAAAAAAATGAGGG + Intergenic
991627917 5:68623701-68623723 CTGGGTACATAAAGAAAGGAAGG - Intergenic
992819739 5:80484437-80484459 CAGGTTAAAAAGTAAAAGGATGG + Intergenic
993697088 5:91074318-91074340 GAGGGTAGAGGGAAAGAGGAGGG - Intronic
994125497 5:96165325-96165347 AGGGGTAGATAGACTAAGGATGG + Intergenic
994130800 5:96225283-96225305 CAAGGTAGAGAGAGAAAGTAAGG - Intergenic
994714311 5:103303527-103303549 GAGGGTAGGTAGAAAATGGGAGG + Intergenic
995569937 5:113469423-113469445 CTGGGTAAATAGTAAAATGAAGG - Intronic
995763194 5:115586156-115586178 GAGTATAGATAGAAAAAGAAAGG + Intronic
996107666 5:119523792-119523814 CAGAGTAGTTGGAAAAAGGTGGG - Intronic
996170410 5:120283264-120283286 CTGGGTAGATAACAAAATGAAGG + Intergenic
996742419 5:126813056-126813078 AATGGTAAAAAGAAAAAGGAAGG - Intronic
996824612 5:127667772-127667794 GAGGGTAGAAAGAAAAAGTCAGG - Intergenic
997715901 5:136042597-136042619 AAGGTTAGAAAGAAACAGGATGG + Intronic
998079785 5:139265226-139265248 CAGGGTATGAAGAAAAAGAAAGG + Intronic
998194869 5:140059925-140059947 GAGGGTAGATGGAGAAAAGAAGG - Intergenic
998297217 5:140982991-140983013 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
999057431 5:148594621-148594643 GCGGGTAGATAGGAGAAGGAAGG - Intronic
999970436 5:156855759-156855781 CAGAGTAGTTAGGAAAAGGAAGG + Intergenic
1000205017 5:159050534-159050556 CAGGGGAGCTGGAGAAAGGAGGG - Intronic
1000997799 5:167976145-167976167 CTGGGTAGATGGATGAAGGAAGG - Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001221482 5:169904308-169904330 CAGCGTTGCAAGAAAAAGGAAGG - Intronic
1001948573 5:175800012-175800034 CAGGGCAAATCGGAAAAGGAAGG - Intronic
1001992692 5:176131406-176131428 CAGAGTACAGACAAAAAGGAAGG - Intronic
1002002412 5:176204872-176204894 CAGAGTACAGACAAAAAGGAAGG - Intergenic
1002224186 5:177706739-177706761 CAGAGTACAGACAAAAAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003783091 6:9451442-9451464 AAGGGGAGCTAGAAAAGGGATGG - Intergenic
1003819978 6:9885204-9885226 CTGGGTACATAGCAAAATGAAGG + Intronic
1005109205 6:22260634-22260656 CATGGTGGATAGATAAAAGAAGG - Intergenic
1005334888 6:24786135-24786157 CAAGGTAGTTAGCAAAAGAATGG - Intergenic
1007741009 6:44009535-44009557 GAGGGAAGGAAGAAAAAGGAAGG + Intergenic
1008826634 6:55702413-55702435 AAGGGTAGAGAGAAAAGTGAAGG - Intergenic
1009556557 6:65178241-65178263 CAGGCAAGATAGTAAAAAGAAGG - Intronic
1009770835 6:68141133-68141155 CAGGGTAGTCAGAAAAAGTTAGG - Intergenic
1010129310 6:72472322-72472344 CTGGGTACATAACAAAAGGAAGG + Intergenic
1010451830 6:76012668-76012690 CAGGGAAGAGAGGAAAGGGATGG - Intronic
1011234880 6:85204886-85204908 CTGGGTAGATAGCGAAATGAAGG + Intergenic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1011559042 6:88596745-88596767 CATGGAAGAAACAAAAAGGAGGG + Intergenic
1012209026 6:96497577-96497599 CTGGGTACATAAAAAAATGAAGG - Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013093796 6:106925519-106925541 GAAGGAAGAAAGAAAAAGGAAGG + Intergenic
1013324964 6:109035975-109035997 AAGGGCAGATACAATAAGGAGGG - Intronic
1013630258 6:111979671-111979693 TAGGGAAGAAAGGAAAAGGAGGG + Intergenic
1013761616 6:113525105-113525127 CAGGATAGATAGTAAACCGATGG + Intergenic
1014796331 6:125728959-125728981 CAGGGCTGCTGGAAAAAGGAGGG + Intergenic
1015079666 6:129208678-129208700 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1017260724 6:152383586-152383608 AAAGGTAGAGAGAAAAAGGAGGG - Intronic
1017584856 6:155909394-155909416 AAGGGTAGCTGGAAAGAGGATGG - Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1018322406 6:162625577-162625599 CAGAGTAGAAAAAAAGAGGAAGG - Intronic
1018699611 6:166416183-166416205 TAGGGTTGATGGAGAAAGGATGG - Intronic
1019769396 7:2874168-2874190 CAGAGTAGATAAAGCAAGGATGG - Intergenic
1019818883 7:3224069-3224091 CAGAGAAGATATAAAAAGAAGGG - Intergenic
1020810252 7:12842435-12842457 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022305570 7:29143699-29143721 CAGACTAGAGAGAAAAAGGTAGG + Intronic
1022551115 7:31239505-31239527 GAGGGAAGAAAGAAAAAGAAAGG + Intergenic
1022673154 7:32474830-32474852 AAGGGCAGAGAGAAAAAGGGAGG + Intergenic
1022871963 7:34489174-34489196 AAGAGCAGATAGAGAAAGGAAGG + Intergenic
1023152440 7:37214658-37214680 CAGGGAAGCTAGATAACGGATGG + Intronic
1023548793 7:41346744-41346766 CAGGGTAGGAGGAAAAAGGAAGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023749440 7:43357220-43357242 CAGGGTATATAGCAAAAGAAAGG + Intronic
1024023106 7:45388534-45388556 ACGGGGAGATAGAAGAAGGATGG - Intergenic
1024343577 7:48291106-48291128 CAAAGCAGAAAGAAAAAGGATGG - Intronic
1024841823 7:53595847-53595869 CAGGGGAGATAGAAGAGGTAGGG - Intergenic
1025575813 7:62639924-62639946 CTGGGTACATAAAAAAACGAAGG + Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026402027 7:70023865-70023887 CAGGGTAGAAGGAAAAACTATGG - Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1028066301 7:86389337-86389359 AGGGGTAGAGAGAAAAAGGGAGG - Intergenic
1028629211 7:92915467-92915489 CAGGAAAGATGGAAAAAGTATGG - Intergenic
1030952316 7:115806335-115806357 AAGTGTAGATAGAACAATGACGG - Intergenic
1030964786 7:115977971-115977993 AATGGAAGATAGAAAAAAGAGGG + Intronic
1031014250 7:116555637-116555659 GAGGAGAGAAAGAAAAAGGAAGG + Intronic
1031704018 7:124959815-124959837 CAGGGTGGATAGGAACAGAAAGG + Intergenic
1031879073 7:127176391-127176413 CAGAGTAGATTGAAAAAACAAGG + Intronic
1032016078 7:128381155-128381177 CAGGGGAGAGAGAAAAGGAATGG - Intergenic
1032593003 7:133210228-133210250 CAGAGTAGTTACAATAAGGATGG - Intergenic
1033111731 7:138585183-138585205 AAAGGAGGATAGAAAAAGGATGG + Exonic
1034403099 7:150879303-150879325 AAGGGAAGAAAGAAAAAAGAAGG + Intergenic
1034649532 7:152678830-152678852 GAGGGTAGATAAAAATAGGTTGG + Intergenic
1035861560 8:3034041-3034063 CAGCACTGATAGAAAAAGGAAGG - Intronic
1036579565 8:10061402-10061424 TAGGTTGGAGAGAAAAAGGATGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1038301757 8:26357113-26357135 CTGGGTAGATGGGAAAAGGATGG + Intronic
1038307927 8:26421351-26421373 GGGGGTGGAGAGAAAAAGGAAGG + Intronic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1039726739 8:40226106-40226128 AAGGGTAGAGATAAAAAGGCAGG - Intergenic
1040088413 8:43369480-43369502 AAGGGTAGCAAGAAAAAGAAAGG - Intergenic
1040712624 8:50207806-50207828 CTGGGTACATAAAGAAAGGAAGG - Intronic
1041131959 8:54710664-54710686 GAGGGGAGCTGGAAAAAGGATGG + Intergenic
1041305054 8:56449019-56449041 CAGGGGAGAGAGAAACAGAAAGG + Intergenic
1041477944 8:58286204-58286226 GAAGGTAGTTAGAAAAGGGAGGG + Intergenic
1041702447 8:60806394-60806416 AAGGCTAGAGAGAAAAAGGTAGG + Intronic
1041726022 8:61018026-61018048 GAGGGAAGATGAAAAAAGGAAGG + Intergenic
1042713407 8:71744717-71744739 CTGGGTAGATAACAAAATGAAGG - Intergenic
1042796951 8:72674748-72674770 AAGGGTAGATAGAAAACTGCAGG + Intronic
1043288878 8:78570801-78570823 CACAGTAGAAAGAAAAAGAATGG - Intronic
1043725413 8:83604623-83604645 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1043762772 8:84089912-84089934 CAGGGTATATATCAAAAGTAAGG - Intergenic
1044204604 8:89477886-89477908 CAGGGTAGAAAGACACAGCAGGG - Intergenic
1045831804 8:106470673-106470695 AAGTGTAGATAGAAAAGAGAAGG + Intronic
1046451983 8:114405431-114405453 CAGGGAAGGAAGGAAAAGGAAGG + Intergenic
1046588398 8:116175968-116175990 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046588427 8:116176161-116176183 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046610061 8:116413208-116413230 CTGGGTACATAGCAAAATGAAGG + Intergenic
1047065897 8:121282913-121282935 AAGGGTTGGAAGAAAAAGGAAGG - Intergenic
1047175074 8:122532852-122532874 CAGGGTGGTGAGAACAAGGAGGG + Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1048055826 8:130863392-130863414 CAGAGTAGATAAAAAAAAAAAGG - Intronic
1048121431 8:131585928-131585950 ACGGGTAGATGGAAGAAGGAAGG - Intergenic
1048149540 8:131880941-131880963 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1048326212 8:133441414-133441436 GAAGGAAGAAAGAAAAAGGAAGG - Intergenic
1048370152 8:133770131-133770153 CAGGGTACAGAGAGAATGGATGG - Intergenic
1048424503 8:134310753-134310775 CTGGGTAGATAATGAAAGGAAGG - Intergenic
1048863325 8:138740098-138740120 CTGTCTAGATAGAAAATGGAAGG - Intronic
1049370261 8:142261021-142261043 CAGGGAGGAGAGAAAGAGGAGGG + Intronic
1049679268 8:143910308-143910330 CAGGGGTGAAAGAGAAAGGAGGG - Intergenic
1050100962 9:2119337-2119359 CAAGGCAGAAAGAAAAGGGAAGG - Intronic
1050273396 9:3970917-3970939 GAGGGGAAATAAAAAAAGGATGG + Intronic
1050976423 9:11944352-11944374 CTGGGTACATAAAAAAATGAAGG + Intergenic
1051195377 9:14558273-14558295 CACGGCAGATGAAAAAAGGAGGG + Intergenic
1051755862 9:20399516-20399538 CATGGTAGATGCACAAAGGAGGG + Intronic
1051800581 9:20928901-20928923 CAGGGAAGAAAGGAAAAGGGAGG - Intronic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1052006234 9:23352477-23352499 CTTGGCAGAAAGAAAAAGGAAGG - Intergenic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1057569374 9:96192641-96192663 CAGTGTAGATAGGGAAAGAATGG + Intergenic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058827241 9:108785982-108786004 TAGGGTAGCTAGAATATGGAAGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059321090 9:113470606-113470628 AAAGGTTGAAAGAAAAAGGATGG - Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1061405672 9:130391910-130391932 GAGGGTGGGTAGAAAAAAGAGGG - Intronic
1185694447 X:2184741-2184763 CTGGATAGATAGAAACAGGTGGG - Intergenic
1186045528 X:5532662-5532684 GAGGGGAGAAAGAAAAAGGAAGG + Intergenic
1186383483 X:9085735-9085757 GAGGGTAGAGGGTAAAAGGAGGG + Intronic
1187360258 X:18619475-18619497 AAAGGTAAATAGAAAAATGAAGG + Intronic
1187738423 X:22328340-22328362 TAGGGTAGAAAGAACATGGAAGG + Intergenic
1188132597 X:26455652-26455674 CAGGAGAGATAGAATAAGGCAGG - Intergenic
1189038200 X:37514769-37514791 TAGGGTAGAGACAAGAAGGAGGG - Intronic
1189081429 X:37977131-37977153 CACAGTAGATGAAAAAAGGAAGG + Intronic
1190239628 X:48647361-48647383 AAGGGTAGAAAGCAAAAGAATGG - Intergenic
1190842093 X:54154625-54154647 AAGGGAAGAAAGAAAATGGAAGG + Intronic
1191644294 X:63463550-63463572 CTGGGTACATAGCAAAATGACGG - Intergenic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1192589231 X:72346196-72346218 CAGGAAAGAGAGATAAAGGATGG + Intronic
1192703431 X:73501212-73501234 CTGGGTAGATAACAAAATGAAGG + Intergenic
1192964462 X:76162223-76162245 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1193067005 X:77270932-77270954 CTGGGTACATAAAAAAACGAAGG + Intergenic
1193315319 X:80058146-80058168 AAGGGAAGGGAGAAAAAGGAAGG + Intergenic
1193315799 X:80063785-80063807 CTGGGTACATAGCAAAATGAAGG - Intergenic
1193813535 X:86080050-86080072 TAGGGTAGATGAAAAAAGGTTGG + Intergenic
1193879086 X:86899690-86899712 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1193889124 X:87021329-87021351 CAGGCAAGATAAAGAAAGGAAGG + Intergenic
1194228906 X:91297754-91297776 CTGGGTAAATAACAAAAGGAAGG - Intergenic
1195261313 X:103134281-103134303 CTGGGTAGATAACAAAATGAAGG + Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195861482 X:109388078-109388100 CAGAGCAGAGAGAAAAAGGTGGG + Intronic
1195988066 X:110653930-110653952 CAGGTTAAAAAGTAAAAGGATGG + Intergenic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196200562 X:112881699-112881721 AAAGGAAGAAAGAAAAAGGAAGG - Intergenic
1196518559 X:116643715-116643737 GAAGGTAGATAGCAGAAGGATGG - Intergenic
1196943218 X:120798163-120798185 CAGGGGAGAGAGAAAAGGAAAGG - Intergenic
1197294254 X:124698298-124698320 CAAGATAGATAGCAAATGGAAGG - Intronic
1197393329 X:125895533-125895555 CAGGGTGGGTAGAGAAAGGTAGG + Intergenic
1197557585 X:127975305-127975327 CAGGCTTCATAGAAAAAGCAGGG + Intergenic
1197598306 X:128494346-128494368 ATGGGTAGAGAGAGAAAGGAGGG + Intergenic
1197634948 X:128904204-128904226 CAGGGAGGAAAGAAAAATGAGGG + Intergenic
1198335548 X:135662755-135662777 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1198588800 X:138153159-138153181 CAGAGTAGAGAGAAATTGGAAGG + Intergenic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1199943539 X:152647964-152647986 GAAGGTGGATGGAAAAAGGAAGG - Intronic
1199971822 X:152867128-152867150 CAAGGCAGAGGGAAAAAGGAAGG - Intronic
1201245089 Y:11995599-11995621 GAGGATAGATAGATAAATGATGG + Intergenic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic
1201781365 Y:17726047-17726069 CATGGTACATTGAAAAACGATGG - Intergenic
1201820188 Y:18179943-18179965 CATGGTACATTGAAAAACGATGG + Intergenic
1201855149 Y:18533540-18533562 CATGGTATATTGAAAAGGGATGG + Intergenic
1201878172 Y:18786844-18786866 CATGGTATATTGAAAAGGGATGG - Intronic
1202127090 Y:21578076-21578098 ATGGGCAGTTAGAAAAAGGATGG - Intergenic