ID: 1026086112

View in Genome Browser
Species Human (GRCh38)
Location 7:67264605-67264627
Sequence CTTCACATAGTGAAGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026086108_1026086112 20 Left 1026086108 7:67264562-67264584 CCTGCTGAGGGTTAGGTTTATGC No data
Right 1026086112 7:67264605-67264627 CTTCACATAGTGAAGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026086112 Original CRISPR CTTCACATAGTGAAGTACCC AGG Intergenic
No off target data available for this crispr