ID: 1026088391

View in Genome Browser
Species Human (GRCh38)
Location 7:67280884-67280906
Sequence TTTCACCATGTTGGCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723238
Summary {0: 87987, 1: 159650, 2: 173325, 3: 160643, 4: 141633}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088391_1026088397 12 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088397 7:67280919-67280941 TAGAAGCACAAAAATGAGCTGGG No data
1026088391_1026088398 20 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088391_1026088396 11 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088396 7:67280918-67280940 CTAGAAGCACAAAAATGAGCTGG No data
1026088391_1026088399 23 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088399 7:67280930-67280952 AAATGAGCTGGGCGTTCTGGTGG No data
1026088391_1026088400 24 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088400 7:67280931-67280953 AATGAGCTGGGCGTTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088391 Original CRISPR TTTCACCATGTTGGCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr