ID: 1026088392

View in Genome Browser
Species Human (GRCh38)
Location 7:67280888-67280910
Sequence AGGGTTTCACCATGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661265
Summary {0: 29630, 1: 119747, 2: 180457, 3: 189702, 4: 141729}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088392_1026088399 19 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088399 7:67280930-67280952 AAATGAGCTGGGCGTTCTGGTGG No data
1026088392_1026088397 8 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088397 7:67280919-67280941 TAGAAGCACAAAAATGAGCTGGG No data
1026088392_1026088400 20 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088400 7:67280931-67280953 AATGAGCTGGGCGTTCTGGTGGG No data
1026088392_1026088396 7 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088396 7:67280918-67280940 CTAGAAGCACAAAAATGAGCTGG No data
1026088392_1026088398 16 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088392 Original CRISPR AGGGTTTCACCATGTTGGCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr