ID: 1026088393

View in Genome Browser
Species Human (GRCh38)
Location 7:67280893-67280915
Sequence GAGACAGGGTTTCACCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432211
Summary {0: 31762, 1: 84237, 2: 130975, 3: 115475, 4: 69762}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088393_1026088397 3 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088397 7:67280919-67280941 TAGAAGCACAAAAATGAGCTGGG No data
1026088393_1026088399 14 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088399 7:67280930-67280952 AAATGAGCTGGGCGTTCTGGTGG No data
1026088393_1026088396 2 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088396 7:67280918-67280940 CTAGAAGCACAAAAATGAGCTGG No data
1026088393_1026088398 11 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088393_1026088400 15 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088400 7:67280931-67280953 AATGAGCTGGGCGTTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088393 Original CRISPR GAGACAGGGTTTCACCATGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr