ID: 1026088394

View in Genome Browser
Species Human (GRCh38)
Location 7:67280907-67280929
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088394_1026088404 28 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088404 7:67280958-67280980 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1026088394_1026088401 24 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088401 7:67280954-67280976 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1026088394_1026088399 0 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088399 7:67280930-67280952 AAATGAGCTGGGCGTTCTGGTGG No data
1026088394_1026088400 1 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088400 7:67280931-67280953 AATGAGCTGGGCGTTCTGGTGGG No data
1026088394_1026088402 25 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088402 7:67280955-67280977 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1026088394_1026088398 -3 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088394 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr