ID: 1026088398

View in Genome Browser
Species Human (GRCh38)
Location 7:67280927-67280949
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088393_1026088398 11 Left 1026088393 7:67280893-67280915 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088394_1026088398 -3 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088392_1026088398 16 Left 1026088392 7:67280888-67280910 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088395_1026088398 -4 Left 1026088395 7:67280908-67280930 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data
1026088391_1026088398 20 Left 1026088391 7:67280884-67280906 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1026088398 7:67280927-67280949 CAAAAATGAGCTGGGCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088398 Original CRISPR CAAAAATGAGCTGGGCGTTC TGG Intergenic
No off target data available for this crispr