ID: 1026088404 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:67280958-67280980 |
| Sequence | TGTAATCCCAGCTACTTGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1343165 | |||
| Summary | {0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026088395_1026088404 | 27 | Left | 1026088395 | 7:67280908-67280930 | CCTGTCTCTTCTAGAAGCACAAA | 0: 8 1: 0 2: 308 3: 12950 4: 191829 |
||
| Right | 1026088404 | 7:67280958-67280980 | TGTAATCCCAGCTACTTGGGAGG | 0: 48952 1: 142577 2: 242332 3: 522592 4: 386712 |
||||
| 1026088394_1026088404 | 28 | Left | 1026088394 | 7:67280907-67280929 | CCCTGTCTCTTCTAGAAGCACAA | 0: 8 1: 0 2: 152 3: 5593 4: 80206 |
||
| Right | 1026088404 | 7:67280958-67280980 | TGTAATCCCAGCTACTTGGGAGG | 0: 48952 1: 142577 2: 242332 3: 522592 4: 386712 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026088404 | Original CRISPR | TGTAATCCCAGCTACTTGGG AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||