ID: 1026088404

View in Genome Browser
Species Human (GRCh38)
Location 7:67280958-67280980
Sequence TGTAATCCCAGCTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1343165
Summary {0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026088395_1026088404 27 Left 1026088395 7:67280908-67280930 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1026088404 7:67280958-67280980 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1026088394_1026088404 28 Left 1026088394 7:67280907-67280929 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1026088404 7:67280958-67280980 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026088404 Original CRISPR TGTAATCCCAGCTACTTGGG AGG Intergenic
Too many off-targets to display for this crispr