ID: 1026092133

View in Genome Browser
Species Human (GRCh38)
Location 7:67309067-67309089
Sequence AACCTCATCTCCCTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026092130_1026092133 -1 Left 1026092130 7:67309045-67309067 CCATGATGACTTCCCTATGGACA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG 0: 1
1: 1
2: 1
3: 19
4: 232
1026092126_1026092133 14 Left 1026092126 7:67309030-67309052 CCAGTACATCCTCCTCCATGATG 0: 1
1: 0
2: 3
3: 10
4: 191
Right 1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG 0: 1
1: 1
2: 1
3: 19
4: 232
1026092128_1026092133 2 Left 1026092128 7:67309042-67309064 CCTCCATGATGACTTCCCTATGG 0: 1
1: 0
2: 1
3: 12
4: 121
Right 1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG 0: 1
1: 1
2: 1
3: 19
4: 232
1026092127_1026092133 5 Left 1026092127 7:67309039-67309061 CCTCCTCCATGATGACTTCCCTA 0: 1
1: 0
2: 12
3: 99
4: 698
Right 1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG 0: 1
1: 1
2: 1
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026092133 Original CRISPR AACCTCATCTCCCTGCTCAC TGG Intergenic
903681962 1:25103248-25103270 TACCCCAGCTCCCTGCTCCCTGG + Intergenic
904598423 1:31660978-31661000 AGCCGCTTCTTCCTGCTCACTGG - Intronic
906610792 1:47200651-47200673 ATCCTCAGCTCCATGCTCAGAGG - Intergenic
911836739 1:102629189-102629211 TACTTTATCTCCCTGCTCTCAGG - Intergenic
912549281 1:110474201-110474223 AAGCTCCTCTCCCTGCCCTCAGG - Intergenic
913047010 1:115082750-115082772 AATATAATCTCCCTGATCACAGG + Intronic
915895853 1:159810072-159810094 ACCTTCTTCTCCCTGCTCCCAGG + Exonic
917499472 1:175573333-175573355 TACCTCACCTCCCTGCTTCCTGG - Intronic
917591020 1:176477083-176477105 AATCTCATCTAACTGCTCTCAGG + Intronic
917716180 1:177740301-177740323 AACCAGTTCTCCTTGCTCACTGG + Intergenic
917921464 1:179754248-179754270 AACCTCTTCTCCCTTTTCCCTGG - Intronic
918386713 1:184015366-184015388 AACCTCATCTCATTGCCCCCAGG + Intronic
918498833 1:185171066-185171088 ACCCTCATCTACCTGCCCAATGG + Intronic
918589927 1:186229534-186229556 AAGCTCATCTCTCTGCTCCTCGG + Intergenic
918920525 1:190703916-190703938 GTCCACAGCTCCCTGCTCACCGG - Intergenic
919904828 1:202071177-202071199 GACCTTACCTCCCTGTTCACCGG + Intergenic
921849804 1:219922937-219922959 AACCAGATCTGCCTGATCACAGG + Intronic
924794349 1:247281894-247281916 AAAGTCATCCCTCTGCTCACTGG - Intergenic
1063725939 10:8637617-8637639 AAGCTCATCTCCCTGCTAGAGGG - Intergenic
1063730748 10:8694544-8694566 AACTCCATCTCCTTGCTCCCAGG + Intergenic
1067456547 10:46423268-46423290 GCCCTCATCTCCCAGCTCTCTGG + Intergenic
1067630654 10:47961371-47961393 GCCCTCATCTCCCAGCTCTCTGG - Intergenic
1067935624 10:50610028-50610050 AACCTCCTCTTCTTGCTCAGTGG + Intronic
1069645726 10:69995111-69995133 ACACTCATCTCCCTGCTCTAGGG - Intergenic
1070685714 10:78479065-78479087 AAACTCATCTCCCTGCCCCATGG - Intergenic
1070741557 10:78906579-78906601 AGCCTCATCACCCTACTCAGAGG - Intergenic
1070986885 10:80696883-80696905 TACTTCCTCTCCCTTCTCACAGG - Intergenic
1072218922 10:93311150-93311172 AATGTTTTCTCCCTGCTCACGGG + Intronic
1072302394 10:94073830-94073852 AACCTCATCTCCCATCTCCTTGG - Intronic
1072636048 10:97179164-97179186 AGCCTCATCTCCATGCTGATGGG + Intronic
1073693954 10:105844522-105844544 CCCCTCCTCTCCCTTCTCACAGG + Intergenic
1074913777 10:117936637-117936659 TATTTCATCTCCATGCTCACAGG + Intergenic
1074924512 10:118053686-118053708 AACCTCATCTCCTTTGTAACAGG - Intergenic
1075746308 10:124730338-124730360 AACCTCAGCTCCTGGTTCACTGG - Intronic
1076631260 10:131853487-131853509 GACCCCGTCACCCTGCTCACGGG - Intergenic
1076631278 10:131853535-131853557 GACCCCGTCACCCTGCTCACGGG - Intergenic
1077143259 11:1034097-1034119 AACACCATCTCCCAGCTGACAGG - Intronic
1077359019 11:2132349-2132371 ACCGCCATCTCCCTTCTCACGGG - Intronic
1077465436 11:2731627-2731649 AACCTGATCTCCATGACCACAGG - Intronic
1078436203 11:11327869-11327891 GACCTCATGGCCCTGCTCACCGG + Intronic
1080446928 11:32345992-32346014 GATCTCATCTCTCTGCCCACAGG - Intergenic
1081597787 11:44471116-44471138 AACTGCCTCTCCATGCTCACTGG - Intergenic
1081620336 11:44615533-44615555 CACCACAACTCCCTGCTCAGGGG + Intronic
1081733728 11:45389344-45389366 AGCCTCACCTGCCAGCTCACTGG + Intergenic
1082997482 11:59265344-59265366 AACCCCACCTCCCAGCCCACTGG + Intergenic
1083311113 11:61784245-61784267 AACCTCATTTCTCTGCTAACTGG + Intronic
1083409138 11:62479952-62479974 GACCTCATCTCCCTCCCCTCTGG - Intronic
1084264884 11:67999754-67999776 AACCGCAGGTCCCAGCTCACAGG + Intronic
1085401955 11:76240855-76240877 AGCCACATCTCCCTCCGCACAGG - Intergenic
1086556372 11:88116111-88116133 CACCTGAACTCCCTGCTCCCAGG + Intronic
1087730235 11:101770060-101770082 ACCCACAGCTCCCTTCTCACAGG + Intronic
1089210383 11:116796540-116796562 AACTTCTTCTCCCATCTCACTGG + Intergenic
1091829205 12:3537611-3537633 AACCTGCTCTGCCTGCTGACTGG + Intronic
1092770223 12:11890014-11890036 AGCCTCATCTTCCTGTTCAATGG - Intronic
1092868581 12:12785810-12785832 ATCCTCATCTCCTTATTCACAGG - Intronic
1093665028 12:21802207-21802229 AACCTCATCACCCTTCTCTGAGG - Intronic
1094066459 12:26366027-26366049 AACCTCTTCTGCTTGCTGACAGG + Intronic
1095982863 12:47982777-47982799 CTCCTCTTCTCCCTGCTCAGTGG + Intronic
1098143189 12:67471719-67471741 GACCTCTCCTCCCTTCTCACTGG - Intergenic
1101203026 12:102456680-102456702 AACCTCTTATCCCTACTCATGGG + Intronic
1102755741 12:115338489-115338511 AGCCTCATCTGCATGCTCAGGGG - Intergenic
1104649704 12:130522698-130522720 CTCCTCCTCTCCCTGCGCACAGG - Intronic
1105959471 13:25317229-25317251 AACCTCATCTTTCTGCTCTATGG - Intronic
1108532869 13:51343862-51343884 AACCCCATCACCCTGCACCCTGG + Intronic
1109340166 13:61046784-61046806 GACCTCGTTTCCATGCTCACTGG - Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1111442498 13:88298181-88298203 AACCACATCTACCTTCTCATGGG + Intergenic
1113769864 13:112900972-112900994 AACCTGAAATCCCTGCTCAGAGG - Intronic
1114282551 14:21206629-21206651 AAGCCCATCCCCCTGCTCCCAGG + Intergenic
1115306082 14:31935145-31935167 AACCTCATCTCCTCTCTGACAGG - Intergenic
1118282234 14:64440104-64440126 TACCTCTTTTCCCTGCCCACAGG + Exonic
1118379781 14:65208191-65208213 AACCTGCACTCCCAGCTCACCGG - Intergenic
1119479965 14:74953052-74953074 TACCTCCTCTACCTGCTCAGGGG + Intronic
1119545313 14:75467655-75467677 AATGTCAGCCCCCTGCTCACTGG - Intronic
1121052831 14:90830675-90830697 AACCTAACCTCCCTTCCCACTGG - Intergenic
1121665703 14:95670610-95670632 ATCCTGATTTCCCTCCTCACAGG - Intergenic
1124414521 15:29464048-29464070 AACATGATCTCCCTTCTCCCCGG - Intronic
1125244886 15:37624194-37624216 AATCTCATCTTCCTGATCAGAGG - Intergenic
1126375867 15:47996120-47996142 AGCCTCGTCTCCCCTCTCACAGG + Intergenic
1126581032 15:50242762-50242784 AACCTCATCTCCCAAATCAGGGG - Exonic
1127281011 15:57492804-57492826 TACCTCCTCTCTCTGCTCATGGG - Intronic
1128797350 15:70475575-70475597 AACATCATCTCCCTCCACAGAGG - Intergenic
1128863909 15:71098275-71098297 AACCTCATCTTCCTGGGCTCAGG + Intronic
1129172022 15:73813859-73813881 ACCCTCATCTCTCCGCACACAGG + Intergenic
1129230535 15:74194859-74194881 AACCTCAGGACCTTGCTCACTGG - Intronic
1130443550 15:83978226-83978248 GACCTCAGCTCCTTGCTTACTGG - Intronic
1131044873 15:89306236-89306258 ATCCTCATCTCCTGGCTCACTGG - Intronic
1131605644 15:93900376-93900398 TACCTCATCTCCCTGGACGCAGG - Intergenic
1132226235 15:100143855-100143877 AACATCATTTCCCTACTCAAAGG - Intronic
1133491031 16:6268263-6268285 AAACTCATTTCCCTGCTAGCAGG + Intronic
1133527044 16:6615814-6615836 AGCCGCATTTCCCTTCTCACAGG + Intronic
1133730198 16:8572107-8572129 TACCTCCTCCTCCTGCTCACTGG - Exonic
1137687934 16:50399711-50399733 CACCTCATCTCCAGGCTCAGGGG + Intergenic
1138104482 16:54280400-54280422 CCCCTCATCTCCCTCCTCTCAGG - Intergenic
1139297925 16:65919123-65919145 AGCTGCATCTCCCGGCTCACAGG - Intergenic
1141519268 16:84566793-84566815 AAAGTCATCTGCCTGCTCCCCGG - Exonic
1141725867 16:85788010-85788032 ACCCCCATCTCCCTGGACACTGG + Intronic
1141979710 16:87542269-87542291 GACCTCAGCTCCCTGGTCTCAGG - Intergenic
1142200475 16:88758786-88758808 AACCATAACTCCCTCCTCACAGG + Intronic
1143747035 17:9002665-9002687 AACCTCAATTCCATGCTAACTGG - Intergenic
1144381660 17:14704885-14704907 AAACACATCTCACTACTCACAGG + Intergenic
1146662214 17:34672398-34672420 AAACTCATCTCCCTGCCCAGTGG - Intergenic
1149665591 17:58362933-58362955 AACCTCATCCAGCGGCTCACTGG - Intronic
1150565015 17:66331116-66331138 AATCTTATCTCCCTGCTCCTTGG + Intronic
1152022286 17:77786517-77786539 ACCCACATCTCCCTTCACACAGG + Intergenic
1155110396 18:22708906-22708928 AGCCCCATCTTCCTGCTGACTGG + Intergenic
1157199471 18:45646753-45646775 CACCTCATCTACCTGCTGAATGG + Intronic
1157407773 18:47437885-47437907 TATCTCATCTCCCTGGTTACAGG - Intergenic
1158517539 18:58143195-58143217 CACATCATATCCCTGTTCACTGG + Intronic
1158632204 18:59125326-59125348 AACCTCACAGCCCTGTTCACAGG - Intergenic
1164389571 19:27806052-27806074 AGCCTCAGCTCCCTGCTCTGCGG - Intergenic
1164913782 19:32033467-32033489 AAACCCATCTCCCTGCCCACAGG - Intergenic
1167137276 19:47624336-47624358 AACCTAACCTGCCTGCTCTCTGG - Intronic
1167433061 19:49464309-49464331 ATCTTCATCTCCCTTCTCCCTGG + Intronic
1168475591 19:56672766-56672788 AACTTCATGACCCTGCTCCCCGG + Intergenic
925864385 2:8213411-8213433 ACCCTCATTTCCCTTCTCTCAGG - Intergenic
925930421 2:8702902-8702924 AAAGTCACCTCTCTGCTCACTGG - Intergenic
926114625 2:10204560-10204582 AACCGCACCTCCCTGCACCCAGG - Intronic
927760567 2:25749802-25749824 GGCCTCTTCTCCCAGCTCACAGG + Exonic
930564834 2:53005638-53005660 AAGCTCAGCTCCCTCCACACTGG + Intergenic
930627996 2:53720067-53720089 AAAGTCATCCCTCTGCTCACTGG + Intronic
930928199 2:56847216-56847238 AACCTCTCCTACCTGCTCAAAGG - Intergenic
935087902 2:99866523-99866545 ACCATCATCACCCTCCTCACTGG + Intronic
936271194 2:111050535-111050557 CACCTCTTTTCTCTGCTCACCGG + Intronic
941023711 2:160437974-160437996 TAGCTAATCTCCCTGATCACAGG - Intronic
942123410 2:172800917-172800939 AACCCCATTTCCCTCCTCATTGG - Intronic
942979442 2:182061799-182061821 AACCCCATCTCCTTGCTCTGGGG - Intronic
945814352 2:214585691-214585713 AGCCTGACCTCCCTGCTCATTGG - Intergenic
946354323 2:219175571-219175593 ATCCTCATTTCCAGGCTCACCGG + Exonic
946764120 2:223024154-223024176 GACCACATCTCACTGATCACAGG + Intergenic
947749933 2:232526660-232526682 AACCTCATCTCCCTGGTGAGAGG + Exonic
1171053714 20:21885627-21885649 GACCTCATCTTCCTGCCCTCTGG + Intergenic
1171363001 20:24603384-24603406 GCCCTCACCTCCCTGCTCAATGG - Intronic
1172597254 20:36157858-36157880 AGGCTCAGCTCCCTGCCCACAGG - Intronic
1172781037 20:37437226-37437248 CACCTCATCTACCTGCTGAGAGG - Intergenic
1173370415 20:42429819-42429841 ATCCTCAGCACCCTGCTCAAGGG - Intronic
1173498989 20:43538884-43538906 CACCTCATCTACCTGGCCACAGG - Intronic
1175264057 20:57692016-57692038 ACCCTCTTCTCCCTTTTCACGGG + Intronic
1175597863 20:60249785-60249807 AACCTCCGCTCCCTGCTCTAGGG + Intergenic
1176158896 20:63638579-63638601 AAACACATCTCCCTCCTAACAGG + Intergenic
1177229282 21:18298721-18298743 CACATCATCTCCCTGCTCACTGG - Intronic
1178660199 21:34501399-34501421 AACCCCATCTCCATTCTCAATGG - Intergenic
1179892314 21:44342318-44342340 GAGGTCATCCCCCTGCTCACCGG - Intergenic
1180997661 22:19973452-19973474 AAGCTCAGCGCCCTGCTCACAGG - Intronic
1181783039 22:25206896-25206918 AAACTCTTTACCCTGCTCACAGG - Intronic
1182280413 22:29215029-29215051 CACCTCATTTACCTGCTCCCCGG - Exonic
1182444159 22:30380479-30380501 TACCTCACCTGCCTGCTCCCTGG - Intronic
1183817169 22:40312234-40312256 AACCTGATCCTCCTGCTCCCAGG - Intronic
1184343860 22:43901036-43901058 GGCCTCCTCTGCCTGCTCACTGG - Intergenic
1184450706 22:44580907-44580929 AACCTCCTCACCCTGGCCACTGG - Intergenic
951295177 3:20924832-20924854 AAAGTCATCCCCCTGCTCATGGG - Intergenic
952902740 3:38120759-38120781 GCCCTCATCTCTCTGCACACAGG - Intronic
952926861 3:38326628-38326650 AAGCTCTGCTCCCTGCTCCCTGG + Intergenic
953043334 3:39274053-39274075 AACCTCATCTGAATGCTCACAGG - Intronic
953708561 3:45249911-45249933 AACTTCCTCTCACTTCTCACTGG - Intergenic
955108411 3:55923368-55923390 AACCTCATACCCCTGGTCCCTGG - Intronic
955356974 3:58239031-58239053 AGCCTCATATTCCTGCTCTCAGG - Intronic
955582295 3:60437055-60437077 AATCTCTTCCCCCTGTTCACAGG + Intronic
958522747 3:95212216-95212238 AAAGTCATCTCACTGCTCACAGG + Intergenic
960537469 3:118829088-118829110 AGCCTCATCTCCCTCCTCAAGGG - Intergenic
961420229 3:126797172-126797194 AACCCTCTCTCCCTGCTCGCCGG - Intronic
962482693 3:135811314-135811336 AAACTCATCTCACTCCTCTCGGG - Intergenic
964498954 3:157327080-157327102 GACCTCATCTCAGTGCCCACTGG - Intronic
965158037 3:165089549-165089571 AACCTCATCTCCCAGGGCCCAGG - Intergenic
966825323 3:183960271-183960293 AAGCTCCTCTCCCATCTCACTGG + Intronic
968509994 4:991357-991379 AACCTCATCTACTTCCTCATGGG - Exonic
969367243 4:6703665-6703687 ACCCTCTTCACCCTGCTCAGAGG + Intergenic
969495642 4:7524709-7524731 AACCGCATCTCTCTTCCCACCGG + Intronic
971101780 4:23474747-23474769 AACCTCACCTTCCAGCTCAAGGG - Intergenic
972580224 4:40388563-40388585 AACCTCATCTCCAGCCACACTGG - Intergenic
973312514 4:48724611-48724633 AACATCATCTCCTGGGTCACAGG + Intronic
975040044 4:69735337-69735359 AACCTGCTCTCCCTGGTCAAAGG + Intronic
975116620 4:70687911-70687933 ATCGCCCTCTCCCTGCTCACAGG - Intergenic
975899959 4:79140012-79140034 AAGCTCTTAGCCCTGCTCACCGG - Intergenic
975985271 4:80196891-80196913 AACCTCATCTCCCAAGCCACGGG + Intronic
978888310 4:113792303-113792325 AATGTCATCTCCCTCCCCACTGG - Intergenic
980178463 4:129375497-129375519 GACCTCATCTTCCTGGGCACAGG - Intergenic
980516337 4:133867254-133867276 AACCATATCTCCCTGTTCCCAGG + Intergenic
980975509 4:139606648-139606670 CTCCTCAACTCCCTGCTCAGGGG - Intronic
981437815 4:144747000-144747022 CACATCATCTCTCTTCTCACTGG - Intergenic
982591955 4:157324678-157324700 AACATGACCTCCCTCCTCACTGG - Intronic
985774386 5:1833239-1833261 ATCCTCATTTCCCTGCTCAAGGG + Intergenic
986779606 5:11052628-11052650 AATCTCATCTCCCTCCTCCCAGG + Intronic
987511471 5:18845773-18845795 AGCCTCATCACCCTTCTTACAGG - Intergenic
987514923 5:18892810-18892832 TGCCCCAGCTCCCTGCTCACAGG - Intergenic
988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG + Intergenic
988981130 5:36570395-36570417 GACCTCATCTCCCTGCTCCGGGG - Intergenic
989146312 5:38253753-38253775 AACCTCATAATTCTGCTCACAGG + Intergenic
990281281 5:54253410-54253432 AACCTCTACTCCCAGCTCCCTGG - Intronic
992324995 5:75651709-75651731 AGCCTCATTTCCCTTCTCCCAGG - Intronic
993308873 5:86303284-86303306 AACTTCTTCTCCCTGCACTCAGG + Intergenic
995064220 5:107841941-107841963 AATCTCTACTCCCAGCTCACTGG - Intergenic
998229959 5:140354824-140354846 AACCTCGGCTCCTGGCTCACAGG + Intergenic
999124802 5:149239256-149239278 AACATTATCTCCCTACTCCCAGG + Exonic
1000793411 5:165634535-165634557 AAAGTCGTCTCTCTGCTCACAGG - Intergenic
1001949644 5:175807403-175807425 AGCCTCCTGTCCCTGCACACAGG + Intronic
1002174551 5:177394135-177394157 ATGCTCAACTCCCTGCTCAAGGG + Exonic
1002180987 5:177431075-177431097 GTCCTCATCCTCCTGCTCACTGG - Intronic
1003014910 6:2460539-2460561 AGCCTCCTCTCCCTGCTCTGCGG - Intergenic
1007403920 6:41622356-41622378 ATGCTCAGCTCCCTGCTCTCTGG + Intergenic
1010275676 6:73966018-73966040 CACCTCACCACTCTGCTCACTGG - Intergenic
1012935062 6:105358944-105358966 AACCTCATCCACCTGGGCACAGG - Intronic
1013079380 6:106799282-106799304 AACCCCATCTTGTTGCTCACTGG + Intergenic
1013391362 6:109689439-109689461 AACCTACTCTCCCTGAACACAGG + Intronic
1016413593 6:143809619-143809641 AACCTCATTTCTGTTCTCACAGG + Intronic
1017025403 6:150176847-150176869 AAACCCATCTCCTTGCCCACAGG - Intronic
1017809507 6:157974788-157974810 AACCACCTCCCCCTGCTCCCCGG + Intergenic
1018677140 6:166232672-166232694 AGCCTCATCTCCCAGCTGGCTGG + Intergenic
1019358677 7:594071-594093 AACTTGCTCTCCCAGCTCACGGG + Intronic
1019852142 7:3570218-3570240 ATCATCACCTCCCTGCCCACTGG - Intronic
1022764165 7:33392074-33392096 AATCTAATCTCCCTGCTCCCTGG + Intronic
1023295817 7:38714184-38714206 AACCTCAGCAGCCTGGTCACTGG - Intergenic
1024557328 7:50614816-50614838 AACATCTTCTCCCTGATCGCTGG - Exonic
1024610481 7:51059897-51059919 ATCCTCATCTCACCCCTCACAGG + Intronic
1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG + Intergenic
1027172379 7:75881864-75881886 AATCCCATCTCCCTGCTCTGCGG + Exonic
1028718880 7:94006173-94006195 AACCTCTTCTCTATTCTCACAGG + Intergenic
1029377563 7:100188944-100188966 GACCTCATCTCCCTGCTCACTGG + Exonic
1031149415 7:118035848-118035870 AACCTCATTTACCTTCTCTCTGG + Intergenic
1033463391 7:141568127-141568149 ATCCACATCTCCCTTCCCACTGG - Intronic
1033637964 7:143229720-143229742 TCCCTCATCTCACTGCTCAGTGG + Intergenic
1035769360 8:2134513-2134535 AACCTCAAATCCCAGCACACAGG - Intronic
1036689031 8:10929765-10929787 AACCTCCTGTCTGTGCTCACAGG - Intronic
1037883559 8:22584914-22584936 AGCCTCAGCACCCTGATCACTGG + Intronic
1039939485 8:42077217-42077239 AAACTCAGCTCACTGCTCACTGG - Intergenic
1040391461 8:46954328-46954350 AAGCTCATGTCCCAGCTCAAAGG + Intergenic
1041931036 8:63286619-63286641 AACTTCAGCTTCCTGCTCAGAGG - Intergenic
1042908439 8:73798941-73798963 ACCCTATTCTCCCTGCTCAATGG + Intronic
1043150186 8:76705485-76705507 ATCCTCATCTCCCGGTTCAGTGG - Exonic
1044749622 8:95403415-95403437 TTCCTCATTGCCCTGCTCACTGG - Intergenic
1047494048 8:125397061-125397083 TTCCACATCTCCCTGCTCCCAGG - Intergenic
1048426060 8:134324480-134324502 CATCTTATCTACCTGCTCACTGG + Intergenic
1049716766 8:144096600-144096622 TACGTCTTCTCCCTGCTCACGGG + Exonic
1051340151 9:16103307-16103329 ACCCAGATCTCCCTGCTCCCAGG - Intergenic
1051677146 9:19569950-19569972 TCCCTCATCTCCCAACTCACAGG + Intronic
1054323232 9:63695024-63695046 AATCTCTGCTCCCTGGTCACAGG - Intergenic
1056287617 9:85107532-85107554 GATCTGATCTCCCTGCTCAAAGG - Intergenic
1057172244 9:92969817-92969839 CACTTCATCCCCCTGCTCACTGG + Intronic
1057356337 9:94334782-94334804 AAACACATCTTACTGCTCACCGG - Intergenic
1057624176 9:96662925-96662947 AACCTCACTTCCCTCTTCACAGG - Intergenic
1057651413 9:96922846-96922868 AAACACATCTTACTGCTCACCGG + Intronic
1058953376 9:109924085-109924107 TACCCCATCTGCCTGCTCTCCGG + Intronic
1059733646 9:117080727-117080749 AAGCTCATCTCTCTGCTCTAAGG - Intronic
1062094208 9:134694697-134694719 AGCCTCATCTCCCTGGTGCCAGG - Intronic
1062122191 9:134839725-134839747 AACCTCCTCACCCTCCCCACCGG - Intronic
1062292582 9:135803566-135803588 ATCCTCATCTGCCTGTGCACTGG + Intergenic
1186421765 X:9432398-9432420 AACCTCATCTCCTTGGTAGCTGG - Intergenic
1189235014 X:39480138-39480160 GATCTCACCTCCCAGCTCACAGG - Intergenic
1189711347 X:43815673-43815695 AACCTCATCTTCCTGGACTCTGG - Intronic
1190220831 X:48511465-48511487 ATCCTCATCTACCTACTCATGGG + Exonic
1191640640 X:63427535-63427557 CATCTCATCACCCTGCTAACAGG - Intergenic
1192205535 X:69093655-69093677 TACCCCATCTCCCTGCCCAGAGG + Intergenic
1195767463 X:108311494-108311516 AACCTCATCTCCTTTCTCTCTGG + Intronic
1197376228 X:125685011-125685033 AAAGTCATCTCTCTGCTCACAGG - Intergenic