ID: 1026093952

View in Genome Browser
Species Human (GRCh38)
Location 7:67325940-67325962
Sequence AGTCCAATAGAACTCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026093951_1026093952 3 Left 1026093951 7:67325914-67325936 CCACATAGGCACAGACTCAGACA No data
Right 1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG No data
1026093950_1026093952 4 Left 1026093950 7:67325913-67325935 CCCACATAGGCACAGACTCAGAC No data
Right 1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG No data
1026093949_1026093952 11 Left 1026093949 7:67325906-67325928 CCAGCAACCCACATAGGCACAGA No data
Right 1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG No data
1026093947_1026093952 28 Left 1026093947 7:67325889-67325911 CCTGGTAAATAAATATTCCAGCA No data
Right 1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026093952 Original CRISPR AGTCCAATAGAACTCCAAAG AGG Intergenic
No off target data available for this crispr