ID: 1026094720

View in Genome Browser
Species Human (GRCh38)
Location 7:67335742-67335764
Sequence TAGGGGGTCGGGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026094708_1026094720 -5 Left 1026094708 7:67335724-67335746 CCATTGGAACTAGCAGCATAGGG No data
Right 1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG No data
1026094706_1026094720 10 Left 1026094706 7:67335709-67335731 CCGATTGGATATTTTCCATTGGA No data
Right 1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026094720 Original CRISPR TAGGGGGTCGGGAGGGGGGA GGG Intergenic
No off target data available for this crispr