ID: 1026095670

View in Genome Browser
Species Human (GRCh38)
Location 7:67344610-67344632
Sequence CTGGAGATGCAGCATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026095670_1026095671 -9 Left 1026095670 7:67344610-67344632 CCTTGCTCATGCTGCATCTCCAG No data
Right 1026095671 7:67344624-67344646 CATCTCCAGTGAGAGCCAACAGG No data
1026095670_1026095677 30 Left 1026095670 7:67344610-67344632 CCTTGCTCATGCTGCATCTCCAG No data
Right 1026095677 7:67344663-67344685 ATATAGTCACTCAGGGCCCCAGG No data
1026095670_1026095674 22 Left 1026095670 7:67344610-67344632 CCTTGCTCATGCTGCATCTCCAG No data
Right 1026095674 7:67344655-67344677 TCTGCTCCATATAGTCACTCAGG No data
1026095670_1026095675 23 Left 1026095670 7:67344610-67344632 CCTTGCTCATGCTGCATCTCCAG No data
Right 1026095675 7:67344656-67344678 CTGCTCCATATAGTCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026095670 Original CRISPR CTGGAGATGCAGCATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr