ID: 1026105723

View in Genome Browser
Species Human (GRCh38)
Location 7:67419277-67419299
Sequence GTGAAGAAACAGAGGGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026105713_1026105723 22 Left 1026105713 7:67419232-67419254 CCAGTACCTGGGGTTAAAGTTTA No data
Right 1026105723 7:67419277-67419299 GTGAAGAAACAGAGGGTCTAGGG No data
1026105716_1026105723 16 Left 1026105716 7:67419238-67419260 CCTGGGGTTAAAGTTTAGGGAAG No data
Right 1026105723 7:67419277-67419299 GTGAAGAAACAGAGGGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026105723 Original CRISPR GTGAAGAAACAGAGGGTCTA GGG Intergenic
No off target data available for this crispr