ID: 1026110014

View in Genome Browser
Species Human (GRCh38)
Location 7:67451656-67451678
Sequence CAGGGTATTGACCAGTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110014_1026110028 30 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110014_1026110025 11 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110025 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
1026110014_1026110021 4 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110021 7:67451683-67451705 CGGTCACCCTGTCTGAGGTCTGG No data
1026110014_1026110023 10 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110023 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
1026110014_1026110027 16 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110027 7:67451695-67451717 CTGAGGTCTGGTGTTGGGGAAGG No data
1026110014_1026110019 -1 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110019 7:67451678-67451700 GGTGCCGGTCACCCTGTCTGAGG No data
1026110014_1026110026 12 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110026 7:67451691-67451713 CTGTCTGAGGTCTGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110014 Original CRISPR CAGGGTATTGACCAGTCCTC AGG (reversed) Intergenic