ID: 1026110017

View in Genome Browser
Species Human (GRCh38)
Location 7:67451674-67451696
Sequence AGACAGGGTGACCGGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110017_1026110029 13 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110029 7:67451710-67451732 GGGGAAGGTGCCTCTCTCTAGGG No data
1026110017_1026110030 14 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110017_1026110025 -7 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110025 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
1026110017_1026110028 12 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110017_1026110023 -8 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110023 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
1026110017_1026110035 24 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110017_1026110031 17 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110031 7:67451714-67451736 AAGGTGCCTCTCTCTAGGGGAGG No data
1026110017_1026110032 20 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110032 7:67451717-67451739 GTGCCTCTCTCTAGGGGAGGAGG No data
1026110017_1026110034 23 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110034 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
1026110017_1026110027 -2 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110027 7:67451695-67451717 CTGAGGTCTGGTGTTGGGGAAGG No data
1026110017_1026110037 26 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110037 7:67451723-67451745 CTCTCTAGGGGAGGAGGTGGGGG No data
1026110017_1026110036 25 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110036 7:67451722-67451744 TCTCTCTAGGGGAGGAGGTGGGG No data
1026110017_1026110026 -6 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110026 7:67451691-67451713 CTGTCTGAGGTCTGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110017 Original CRISPR AGACAGGGTGACCGGCACCA GGG (reversed) Intergenic