ID: 1026110020

View in Genome Browser
Species Human (GRCh38)
Location 7:67451682-67451704
Sequence CAGACCTCAGACAGGGTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110020_1026110036 17 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110036 7:67451722-67451744 TCTCTCTAGGGGAGGAGGTGGGG No data
1026110020_1026110029 5 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110029 7:67451710-67451732 GGGGAAGGTGCCTCTCTCTAGGG No data
1026110020_1026110035 16 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110020_1026110039 30 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110039 7:67451735-67451757 GGAGGTGGGGGCTTGCTTCTGGG No data
1026110020_1026110027 -10 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110027 7:67451695-67451717 CTGAGGTCTGGTGTTGGGGAAGG No data
1026110020_1026110028 4 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110020_1026110038 29 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110020_1026110030 6 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110020_1026110034 15 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110034 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
1026110020_1026110037 18 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110037 7:67451723-67451745 CTCTCTAGGGGAGGAGGTGGGGG No data
1026110020_1026110031 9 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110031 7:67451714-67451736 AAGGTGCCTCTCTCTAGGGGAGG No data
1026110020_1026110032 12 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110032 7:67451717-67451739 GTGCCTCTCTCTAGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110020 Original CRISPR CAGACCTCAGACAGGGTGAC CGG (reversed) Intergenic