ID: 1026110022

View in Genome Browser
Species Human (GRCh38)
Location 7:67451689-67451711
Sequence CCAACACCAGACCTCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110022_1026110038 22 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110022_1026110028 -3 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110022_1026110030 -1 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110022_1026110032 5 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110032 7:67451717-67451739 GTGCCTCTCTCTAGGGGAGGAGG No data
1026110022_1026110034 8 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110034 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
1026110022_1026110037 11 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110037 7:67451723-67451745 CTCTCTAGGGGAGGAGGTGGGGG No data
1026110022_1026110039 23 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110039 7:67451735-67451757 GGAGGTGGGGGCTTGCTTCTGGG No data
1026110022_1026110029 -2 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110029 7:67451710-67451732 GGGGAAGGTGCCTCTCTCTAGGG No data
1026110022_1026110036 10 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110036 7:67451722-67451744 TCTCTCTAGGGGAGGAGGTGGGG No data
1026110022_1026110040 29 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110040 7:67451741-67451763 GGGGGCTTGCTTCTGGGCTGTGG No data
1026110022_1026110031 2 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110031 7:67451714-67451736 AAGGTGCCTCTCTCTAGGGGAGG No data
1026110022_1026110035 9 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110022 Original CRISPR CCAACACCAGACCTCAGACA GGG (reversed) Intergenic
No off target data available for this crispr