ID: 1026110028

View in Genome Browser
Species Human (GRCh38)
Location 7:67451709-67451731
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110017_1026110028 12 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110018_1026110028 11 Left 1026110018 7:67451675-67451697 CCTGGTGCCGGTCACCCTGTCTG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110014_1026110028 30 Left 1026110014 7:67451656-67451678 CCTGAGGACTGGTCAATACCCTG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110020_1026110028 4 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110022_1026110028 -3 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data
1026110024_1026110028 -4 Left 1026110024 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
Right 1026110028 7:67451709-67451731 TGGGGAAGGTGCCTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110028 Original CRISPR TGGGGAAGGTGCCTCTCTCT AGG Intergenic