ID: 1026110030

View in Genome Browser
Species Human (GRCh38)
Location 7:67451711-67451733
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110020_1026110030 6 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110022_1026110030 -1 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110017_1026110030 14 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110024_1026110030 -2 Left 1026110024 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data
1026110018_1026110030 13 Left 1026110018 7:67451675-67451697 CCTGGTGCCGGTCACCCTGTCTG No data
Right 1026110030 7:67451711-67451733 GGGAAGGTGCCTCTCTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110030 Original CRISPR GGGAAGGTGCCTCTCTCTAG GGG Intergenic
No off target data available for this crispr