ID: 1026110033

View in Genome Browser
Species Human (GRCh38)
Location 7:67451720-67451742
Sequence CCACCTCCTCCCCTAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110033_1026110040 -2 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110040 7:67451741-67451763 GGGGGCTTGCTTCTGGGCTGTGG No data
1026110033_1026110039 -8 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110039 7:67451735-67451757 GGAGGTGGGGGCTTGCTTCTGGG No data
1026110033_1026110038 -9 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110033_1026110041 11 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110041 7:67451754-67451776 TGGGCTGTGGCTGTGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110033 Original CRISPR CCACCTCCTCCCCTAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr