ID: 1026110035

View in Genome Browser
Species Human (GRCh38)
Location 7:67451721-67451743
Sequence CTCTCTCTAGGGGAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110020_1026110035 16 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110024_1026110035 8 Left 1026110024 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110017_1026110035 24 Left 1026110017 7:67451674-67451696 CCCTGGTGCCGGTCACCCTGTCT No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110018_1026110035 23 Left 1026110018 7:67451675-67451697 CCTGGTGCCGGTCACCCTGTCTG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data
1026110022_1026110035 9 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110035 Original CRISPR CTCTCTCTAGGGGAGGAGGT GGG Intergenic
No off target data available for this crispr