ID: 1026110038

View in Genome Browser
Species Human (GRCh38)
Location 7:67451734-67451756
Sequence AGGAGGTGGGGGCTTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110024_1026110038 21 Left 1026110024 7:67451690-67451712 CCTGTCTGAGGTCTGGTGTTGGG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110020_1026110038 29 Left 1026110020 7:67451682-67451704 CCGGTCACCCTGTCTGAGGTCTG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110033_1026110038 -9 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data
1026110022_1026110038 22 Left 1026110022 7:67451689-67451711 CCCTGTCTGAGGTCTGGTGTTGG No data
Right 1026110038 7:67451734-67451756 AGGAGGTGGGGGCTTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110038 Original CRISPR AGGAGGTGGGGGCTTGCTTC TGG Intergenic
No off target data available for this crispr