ID: 1026110041

View in Genome Browser
Species Human (GRCh38)
Location 7:67451754-67451776
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026110033_1026110041 11 Left 1026110033 7:67451720-67451742 CCTCTCTCTAGGGGAGGAGGTGG No data
Right 1026110041 7:67451754-67451776 TGGGCTGTGGCTGTGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026110041 Original CRISPR TGGGCTGTGGCTGTGCTCTG AGG Intergenic
No off target data available for this crispr