ID: 1026111303

View in Genome Browser
Species Human (GRCh38)
Location 7:67460816-67460838
Sequence ACAACTGGTCAGTTTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026111303_1026111312 24 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111312 7:67460863-67460885 GTGTTTTAGGCCAACAAACCAGG No data
1026111303_1026111314 29 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111314 7:67460868-67460890 TTAGGCCAACAAACCAGGAAGGG No data
1026111303_1026111311 11 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111311 7:67460850-67460872 GGTAACATTTCAGGTGTTTTAGG No data
1026111303_1026111313 28 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111313 7:67460867-67460889 TTTAGGCCAACAAACCAGGAAGG No data
1026111303_1026111307 -10 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111307 7:67460829-67460851 GACCAGTTGTGGCCTTAGGCAGG No data
1026111303_1026111310 2 Left 1026111303 7:67460816-67460838 CCTGCCTGAAACTGACCAGTTGT No data
Right 1026111310 7:67460841-67460863 CCTTAGGCAGGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026111303 Original CRISPR ACAACTGGTCAGTTTCAGGC AGG (reversed) Intergenic
No off target data available for this crispr