ID: 1026111926

View in Genome Browser
Species Human (GRCh38)
Location 7:67465314-67465336
Sequence CAGCAGCAACAGCTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026111918_1026111926 9 Left 1026111918 7:67465282-67465304 CCCACCTACCCCATGGTCTTCTG No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111919_1026111926 8 Left 1026111919 7:67465283-67465305 CCACCTACCCCATGGTCTTCTGC No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111914_1026111926 17 Left 1026111914 7:67465274-67465296 CCTTCCCACCCACCTACCCCATG No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111921_1026111926 1 Left 1026111921 7:67465290-67465312 CCCCATGGTCTTCTGCAGTAGCC No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111917_1026111926 12 Left 1026111917 7:67465279-67465301 CCACCCACCTACCCCATGGTCTT No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111916_1026111926 13 Left 1026111916 7:67465278-67465300 CCCACCCACCTACCCCATGGTCT No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111923_1026111926 -1 Left 1026111923 7:67465292-67465314 CCATGGTCTTCTGCAGTAGCCAC No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111913_1026111926 18 Left 1026111913 7:67465273-67465295 CCCTTCCCACCCACCTACCCCAT No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111920_1026111926 5 Left 1026111920 7:67465286-67465308 CCTACCCCATGGTCTTCTGCAGT No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data
1026111922_1026111926 0 Left 1026111922 7:67465291-67465313 CCCATGGTCTTCTGCAGTAGCCA No data
Right 1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026111926 Original CRISPR CAGCAGCAACAGCTGGAGCA TGG Intergenic
No off target data available for this crispr