ID: 1026123028

View in Genome Browser
Species Human (GRCh38)
Location 7:67554160-67554182
Sequence CAAGCTCCTGTATCATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026123026_1026123028 8 Left 1026123026 7:67554129-67554151 CCTGACTCTTATTGTCTCTTTAA No data
Right 1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG No data
1026123024_1026123028 17 Left 1026123024 7:67554120-67554142 CCTCAACTCCCTGACTCTTATTG No data
Right 1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG No data
1026123025_1026123028 9 Left 1026123025 7:67554128-67554150 CCCTGACTCTTATTGTCTCTTTA No data
Right 1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026123028 Original CRISPR CAAGCTCCTGTATCATGCTC TGG Intergenic
No off target data available for this crispr