ID: 1026126565

View in Genome Browser
Species Human (GRCh38)
Location 7:67584762-67584784
Sequence GCACCATGACAGTTTACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026126561_1026126565 -1 Left 1026126561 7:67584740-67584762 CCTCACTGCTACATTCCCACCAG 0: 20
1: 481
2: 480
3: 323
4: 406
Right 1026126565 7:67584762-67584784 GCACCATGACAGTTTACAAGTGG No data
1026126560_1026126565 10 Left 1026126560 7:67584729-67584751 CCTCTGGTCATCCTCACTGCTAC 0: 159
1: 373
2: 589
3: 505
4: 680
Right 1026126565 7:67584762-67584784 GCACCATGACAGTTTACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026126565 Original CRISPR GCACCATGACAGTTTACAAG TGG Intergenic
No off target data available for this crispr