ID: 1026127655

View in Genome Browser
Species Human (GRCh38)
Location 7:67593690-67593712
Sequence TGCCATCCTCCCAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026127655_1026127658 -2 Left 1026127655 7:67593690-67593712 CCAACCTCATTGGGAGGATGGCA No data
Right 1026127658 7:67593711-67593733 CAGGTGCAGCTCTCTAGAGCAGG No data
1026127655_1026127659 5 Left 1026127655 7:67593690-67593712 CCAACCTCATTGGGAGGATGGCA No data
Right 1026127659 7:67593718-67593740 AGCTCTCTAGAGCAGGTTAGAGG No data
1026127655_1026127661 21 Left 1026127655 7:67593690-67593712 CCAACCTCATTGGGAGGATGGCA No data
Right 1026127661 7:67593734-67593756 TTAGAGGACTGTGCAATGCAGGG No data
1026127655_1026127660 20 Left 1026127655 7:67593690-67593712 CCAACCTCATTGGGAGGATGGCA No data
Right 1026127660 7:67593733-67593755 GTTAGAGGACTGTGCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026127655 Original CRISPR TGCCATCCTCCCAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr