ID: 1026128542

View in Genome Browser
Species Human (GRCh38)
Location 7:67600986-67601008
Sequence CTCTGTGCACAAAAGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026128534_1026128542 29 Left 1026128534 7:67600934-67600956 CCAGCTGCCATGAAAAAGAGCAA No data
Right 1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG No data
1026128539_1026128542 -10 Left 1026128539 7:67600973-67600995 CCCCAGGGAAACACTCTGTGCAC No data
Right 1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG No data
1026128535_1026128542 22 Left 1026128535 7:67600941-67600963 CCATGAAAAAGAGCAACAGTTCA No data
Right 1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG No data
1026128538_1026128542 -3 Left 1026128538 7:67600966-67600988 CCACATTCCCCAGGGAAACACTC No data
Right 1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026128542 Original CRISPR CTCTGTGCACAAAAGCAATT TGG Intergenic
No off target data available for this crispr