ID: 1026131836

View in Genome Browser
Species Human (GRCh38)
Location 7:67627380-67627402
Sequence TTGAGAAAACAGAAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026131832_1026131836 21 Left 1026131832 7:67627336-67627358 CCTGAGCCTAGAAGATCTTGTGA No data
Right 1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG No data
1026131834_1026131836 -4 Left 1026131834 7:67627361-67627383 CCAAAAAGTAAGAAACTATTTGA No data
Right 1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG No data
1026131833_1026131836 15 Left 1026131833 7:67627342-67627364 CCTAGAAGATCTTGTGATGCCAA No data
Right 1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026131836 Original CRISPR TTGAGAAAACAGAAGTATGG AGG Intergenic
No off target data available for this crispr