ID: 1026132267

View in Genome Browser
Species Human (GRCh38)
Location 7:67630333-67630355
Sequence TGATCAGTAGACAGGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026132264_1026132267 -5 Left 1026132264 7:67630315-67630337 CCACTGACACAACTCTGTTGATC No data
Right 1026132267 7:67630333-67630355 TGATCAGTAGACAGGGTATCTGG No data
1026132263_1026132267 -2 Left 1026132263 7:67630312-67630334 CCACCACTGACACAACTCTGTTG No data
Right 1026132267 7:67630333-67630355 TGATCAGTAGACAGGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026132267 Original CRISPR TGATCAGTAGACAGGGTATC TGG Intergenic
No off target data available for this crispr