ID: 1026148408

View in Genome Browser
Species Human (GRCh38)
Location 7:67768188-67768210
Sequence AACTTCAGCAACAGTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026148408_1026148412 -5 Left 1026148408 7:67768188-67768210 CCCATTTTACTGTTGCTGAAGTT No data
Right 1026148412 7:67768206-67768228 AAGTTGAGGCTCTGGCAGCTAGG No data
1026148408_1026148415 21 Left 1026148408 7:67768188-67768210 CCCATTTTACTGTTGCTGAAGTT No data
Right 1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG No data
1026148408_1026148414 20 Left 1026148408 7:67768188-67768210 CCCATTTTACTGTTGCTGAAGTT No data
Right 1026148414 7:67768231-67768253 GATTTGCAAATGGCAGAGCTAGG No data
1026148408_1026148413 10 Left 1026148408 7:67768188-67768210 CCCATTTTACTGTTGCTGAAGTT No data
Right 1026148413 7:67768221-67768243 CAGCTAGGATGATTTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026148408 Original CRISPR AACTTCAGCAACAGTAAAAT GGG (reversed) Intergenic