ID: 1026148415

View in Genome Browser
Species Human (GRCh38)
Location 7:67768232-67768254
Sequence ATTTGCAAATGGCAGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026148409_1026148415 20 Left 1026148409 7:67768189-67768211 CCATTTTACTGTTGCTGAAGTTG No data
Right 1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG No data
1026148408_1026148415 21 Left 1026148408 7:67768188-67768210 CCCATTTTACTGTTGCTGAAGTT No data
Right 1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026148415 Original CRISPR ATTTGCAAATGGCAGAGCTA GGG Intergenic