ID: 1026149623

View in Genome Browser
Species Human (GRCh38)
Location 7:67776921-67776943
Sequence CAGGATGTGCAAAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026149623_1026149626 -9 Left 1026149623 7:67776921-67776943 CCTTCAGCCCTTTGCACATCCTG No data
Right 1026149626 7:67776935-67776957 CACATCCTGTTTCCTCTGTGAGG No data
1026149623_1026149629 13 Left 1026149623 7:67776921-67776943 CCTTCAGCCCTTTGCACATCCTG No data
Right 1026149629 7:67776957-67776979 GATTCCTTATCTCTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026149623 Original CRISPR CAGGATGTGCAAAGGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr