ID: 1026154922

View in Genome Browser
Species Human (GRCh38)
Location 7:67818395-67818417
Sequence ATGGAGATGTTCAGCTAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026154915_1026154922 8 Left 1026154915 7:67818364-67818386 CCAGGGCTGCAACCCATCCTTGC No data
Right 1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG No data
1026154919_1026154922 -9 Left 1026154919 7:67818381-67818403 CCTTGCACGATGCAATGGAGATG No data
Right 1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG No data
1026154916_1026154922 -4 Left 1026154916 7:67818376-67818398 CCCATCCTTGCACGATGCAATGG No data
Right 1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG No data
1026154918_1026154922 -5 Left 1026154918 7:67818377-67818399 CCATCCTTGCACGATGCAATGGA No data
Right 1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026154922 Original CRISPR ATGGAGATGTTCAGCTAGCG GGG Intergenic
No off target data available for this crispr