ID: 1026158947

View in Genome Browser
Species Human (GRCh38)
Location 7:67852194-67852216
Sequence TAGAATAAGGAAGATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026158943_1026158947 -3 Left 1026158943 7:67852174-67852196 CCTAAAAGGAGAATAAGAATTAG No data
Right 1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026158947 Original CRISPR TAGAATAAGGAAGATGAGGA GGG Intergenic
No off target data available for this crispr