ID: 1026164983

View in Genome Browser
Species Human (GRCh38)
Location 7:67901552-67901574
Sequence AACACAGGAAAACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026164978_1026164983 24 Left 1026164978 7:67901505-67901527 CCAAGAGGTCTCATGCTTACAAC No data
Right 1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026164983 Original CRISPR AACACAGGAAAACCCCAAAG TGG Intergenic
No off target data available for this crispr