ID: 1026182041

View in Genome Browser
Species Human (GRCh38)
Location 7:68050085-68050107
Sequence CATGCCCACTTAATTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026182041_1026182046 9 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182046 7:68050117-68050139 ACCCATAGTCCCAGTTACTTGGG No data
1026182041_1026182052 21 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182052 7:68050129-68050151 AGTTACTTGGGAGGCTGAAGTGG 0: 65
1: 2048
2: 17508
3: 33326
4: 52943
1026182041_1026182045 8 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182045 7:68050116-68050138 CACCCATAGTCCCAGTTACTTGG No data
1026182041_1026182049 12 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182049 7:68050120-68050142 CATAGTCCCAGTTACTTGGGAGG No data
1026182041_1026182053 22 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182053 7:68050130-68050152 GTTACTTGGGAGGCTGAAGTGGG 0: 69
1: 2199
2: 22963
3: 122063
4: 224857
1026182041_1026182054 25 Left 1026182041 7:68050085-68050107 CCCCAAAAAATTAAGTGGGCATG No data
Right 1026182054 7:68050133-68050155 ACTTGGGAGGCTGAAGTGGGAGG 0: 943
1: 10620
2: 25031
3: 71990
4: 135705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026182041 Original CRISPR CATGCCCACTTAATTTTTTG GGG (reversed) Intergenic
No off target data available for this crispr