ID: 1026185957

View in Genome Browser
Species Human (GRCh38)
Location 7:68082590-68082612
Sequence CTCACTTCCCAGATGAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026185957_1026185962 6 Left 1026185957 7:68082590-68082612 CCGCCCTTCATCTGGGAAGTGAG No data
Right 1026185962 7:68082619-68082641 CTCTGCCCAGCCGCCCCGTCTGG 0: 87
1: 1165
2: 2253
3: 4984
4: 8735
1026185957_1026185971 30 Left 1026185957 7:68082590-68082612 CCGCCCTTCATCTGGGAAGTGAG No data
Right 1026185971 7:68082643-68082665 AAGTGAGGAGCGCCTCTGCCCGG 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
1026185957_1026185966 15 Left 1026185957 7:68082590-68082612 CCGCCCTTCATCTGGGAAGTGAG No data
Right 1026185966 7:68082628-68082650 GCCGCCCCGTCTGGGAAGTGAGG 0: 520
1: 5595
2: 10717
3: 6810
4: 4127
1026185957_1026185963 7 Left 1026185957 7:68082590-68082612 CCGCCCTTCATCTGGGAAGTGAG No data
Right 1026185963 7:68082620-68082642 TCTGCCCAGCCGCCCCGTCTGGG 0: 91
1: 1111
2: 2357
3: 5688
4: 7488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026185957 Original CRISPR CTCACTTCCCAGATGAAGGG CGG (reversed) Intergenic
No off target data available for this crispr