ID: 1026186573

View in Genome Browser
Species Human (GRCh38)
Location 7:68086396-68086418
Sequence ACTCTTCCAGAGCTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026186573_1026186578 26 Left 1026186573 7:68086396-68086418 CCACAGCACAGCTCTGGAAGAGT No data
Right 1026186578 7:68086445-68086467 GAACTAATTATCTTTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026186573 Original CRISPR ACTCTTCCAGAGCTGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr