ID: 1026195526

View in Genome Browser
Species Human (GRCh38)
Location 7:68170199-68170221
Sequence CGGGCTGGTGGGAGACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026195516_1026195526 15 Left 1026195516 7:68170161-68170183 CCGCTGCAGCCTTGTGCAACTAG No data
Right 1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG No data
1026195514_1026195526 26 Left 1026195514 7:68170150-68170172 CCTCAGTGTTCCCGCTGCAGCCT No data
Right 1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG No data
1026195517_1026195526 6 Left 1026195517 7:68170170-68170192 CCTTGTGCAACTAGAATTTAGAG No data
Right 1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG No data
1026195515_1026195526 16 Left 1026195515 7:68170160-68170182 CCCGCTGCAGCCTTGTGCAACTA No data
Right 1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026195526 Original CRISPR CGGGCTGGTGGGAGACTTGG GGG Intergenic
No off target data available for this crispr