ID: 1026199330

View in Genome Browser
Species Human (GRCh38)
Location 7:68200621-68200643
Sequence TGGAATTATACCTCTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026199323_1026199330 2 Left 1026199323 7:68200596-68200618 CCAAAACCCTAACAGACTCTTCT No data
Right 1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG No data
1026199322_1026199330 3 Left 1026199322 7:68200595-68200617 CCCAAAACCCTAACAGACTCTTC No data
Right 1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG No data
1026199325_1026199330 -4 Left 1026199325 7:68200602-68200624 CCCTAACAGACTCTTCTCCTGGA No data
Right 1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG No data
1026199326_1026199330 -5 Left 1026199326 7:68200603-68200625 CCTAACAGACTCTTCTCCTGGAA No data
Right 1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG No data
1026199321_1026199330 13 Left 1026199321 7:68200585-68200607 CCGCTTATTTCCCAAAACCCTAA No data
Right 1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026199330 Original CRISPR TGGAATTATACCTCTTGGAT GGG Intergenic
No off target data available for this crispr