ID: 1026203584

View in Genome Browser
Species Human (GRCh38)
Location 7:68236175-68236197
Sequence CAGCTCTAGTTTAAAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026203581_1026203584 27 Left 1026203581 7:68236125-68236147 CCAACTTATGGCTTGATGCAGGA No data
Right 1026203584 7:68236175-68236197 CAGCTCTAGTTTAAAAACTGTGG No data
1026203582_1026203584 -6 Left 1026203582 7:68236158-68236180 CCAGTAGCCTGAACATGCAGCTC No data
Right 1026203584 7:68236175-68236197 CAGCTCTAGTTTAAAAACTGTGG No data
1026203579_1026203584 28 Left 1026203579 7:68236124-68236146 CCCAACTTATGGCTTGATGCAGG No data
Right 1026203584 7:68236175-68236197 CAGCTCTAGTTTAAAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026203584 Original CRISPR CAGCTCTAGTTTAAAAACTG TGG Intergenic
No off target data available for this crispr