ID: 1026204063

View in Genome Browser
Species Human (GRCh38)
Location 7:68240152-68240174
Sequence CCAGGGCTTAGATACAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026204063_1026204068 7 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204068 7:68240182-68240204 TGGCACTGCCTCCTCTAGAGTGG No data
1026204063_1026204069 8 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG No data
1026204063_1026204072 15 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204072 7:68240190-68240212 CCTCCTCTAGAGTGGGTAAAGGG No data
1026204063_1026204074 24 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204074 7:68240199-68240221 GAGTGGGTAAAGGGTCTGCTTGG No data
1026204063_1026204070 14 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204070 7:68240189-68240211 GCCTCCTCTAGAGTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026204063 Original CRISPR CCAGGGCTTAGATACAAGAC AGG (reversed) Intergenic