ID: 1026204066

View in Genome Browser
Species Human (GRCh38)
Location 7:68240169-68240191
Sequence GGCAGTGCCAGTAAAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026204066_1026204068 -10 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204068 7:68240182-68240204 TGGCACTGCCTCCTCTAGAGTGG No data
1026204066_1026204074 7 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204074 7:68240199-68240221 GAGTGGGTAAAGGGTCTGCTTGG No data
1026204066_1026204072 -2 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204072 7:68240190-68240212 CCTCCTCTAGAGTGGGTAAAGGG No data
1026204066_1026204070 -3 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204070 7:68240189-68240211 GCCTCCTCTAGAGTGGGTAAAGG No data
1026204066_1026204069 -9 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026204066 Original CRISPR GGCAGTGCCAGTAAAGACCA GGG (reversed) Intergenic
No off target data available for this crispr